2nd PUC

You can Download Chapter 1 Introduction to Micro Economics Questions and Answers, Notes, 2nd PUC Economics Question Bank with Answers Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Economics Question Bank Chapter 1 Introduction to Micro Economics

2nd PUC Economics Introduction to Micro Economics One Mark Questions and Answers

Question 1.
What do you mean by Economics?
Answer:
The term ‘Economics’ is derived from the Greek words ‘OIKOS” and “NOMOS which mean Household and management respectively. It studies the problem of choice at the individual social, national and international levels.

Question 2.
Define an economy.
Answer:
An economy is a mechanism through which the scarce resources are prioritized and organized for the production of goods and services. It also refers to a geographical-area where economic activities take place.

Question 3.
Why does an economic problem arise?
Answer:
An economic problem arises because of limited resources and unlimited wants and alternative uses of resources. While trying to allocate limited resources to satisfy unlimited wants, the problem of choice arises.

Question 4.
What is Planned economy?
Answer:
A Planned economy, also called as Socialistic economy is that economy where the economic activities are controlled by the central Government. Here, the Government takes decisions about the allocation of resources in accordance with objectives to attain economic and social welfare. Example, Russia, China, North Korea etc.

Question 5.
What is a Market economy?
Answer:
A Market economy also known as Capitalistic economy is that economy in which the economic decisions are undertaken on the basis of market mechanism by the private entrepreneurs It functions on demand and supply conditions. Example, USA.

Question 6.
What do you mean by mixed economy?
Answer:
A mixed economy is that economy in which we can see co-existence of both private and public sector enterprises. It is a combination of both Socialistic and Capitalistic features.

Question 7.
What is Positive economics?
Answer:
The Positive Economics is the study of ‘what was’ and ‘what is’ under the given set of circumstances. It deals with the scientific explanation of the working of the economy.

Question 8.
What is Normative Economics?
Answer:
The Normative Economics studies ‘what ought to be’. It explains about ‘what should be and should not be done’.

Question 9.
Define Micro Economics.
Answer:
Micro economics is the study of the economic actions of individuals and small groups of individuals. According to Boulding, “It is the study of particular firms, particular households, individual prices, wages, income, individual industries, particular commodities”.

Question 10.
Who first coined the terms ‘Micro’ and ‘Macro’ Economics?
Answer:
Prof.Ragner Frisch, the Nobel Prize winner in Economics (1920), coined the words Micro and Macro Economics for the first time.

Question 11.
Is the study of a sugar factory, a Micro-Economic study or a Macro-Economic study?
Answer:
The study of a Sugar factory is a Micro-Economic study.

Question 12.
What is Deductive Method of Economics?
Answer:
It is one of the methods of study of economics in which the conclusions are drawn from the general to the particular or from the universal to the individual.

2nd PUC Economics Introduction to Micro Economics Two Marks Questions and Answers

Question 1.
What is an economic problem and why does it arise?
Answer:
An economic problem is the problem of choice which arises because of limited resources and unlimited wants and the alternative uses of resources. The scarcity of resources is the main cause for this economic problem.

Question 2.
What are the basic functions of an economy?
Answer:
The basic functions of any economy are Production, Consumption, Distribution, Exchange, Economic planning and Social welfare.

Question 3.
Name the basic problems of an economy.
Answer:
The basic problems of an economy are What to produce, How to produce and for Whom to produce.

Question 4.
Name the types of economics.
Answer:
The types of economies are

1. Socialistic or Centrally planned Economy
2. Capitalistic or Market Economy and
3. Mixed Economy.

Question 5.
Give two examples of Centrally Planned economy.
Answer:
The Centrally planned or Socialistic economies are North Korea, Cuba, Russia, China and Vietnam.

Question 6.
Give two examples of a Capitalistic Economy.
Answer:
The examples for Capitalistic or Market Economy are USA, Japan, Australia, UK etc.

Question 7.
mention any two differences between Positive and Normative Economics.
Answer:

Positive Economics.	Normative Economics
The Positive Economics is the study of ‘what was’ and ‘what is’ under the given set of circumstances.	Here we study how the different mechanisms function.
It deals with the scientific explanation of the working of the economy.	Here we study how the different mechanisms function.
Here we study how the different mechanisms function.	Here we try to understand that whether the mechanisms are desirable or not.

Question 8.
Write any four practical importances of Micro-Economics.
Answer:

1. It helps in allocation of resources.
2. Provides solution to the problem of choice.
3. Helps in formulating various.economic policies.
4. Explains determination of the price.
5. Helps to know the working of an economy.

Question 9:
Mention any two limitations of Micro Economics.
Answer:

1. It has unrealistic assumptions.
2. It is based on unrealistic analysis.
3. Narrow in scope.

Question 10:
What is Inductive Method of Economics?
Answer:
It is the process of reasoning from a part to the whole, from particular to general or from individual to the universal.

2nd PUC Economics Introduction to Micro Economics Five Marks Questions and Answers

Question 1.
What is a centrally planned economy? How does it solve basic problems?
Answer:
A centrally planned economy also called as socialistic economy is that economy where the economic activities are controlled by the central Government. Here, the Government takes decisions about the allocation of resources in accordance with objectives to attain economic . and social welfare. Example, Russia, China, North Korea etc.

Here, the basic economic problems are solved as follows:
The Government takes decisions about the allocation of resources in accordance with the predetermined goals and objectives to attain maximum social welfare. Government decides what to produce, how to produce and what prices are to be fixed.

• Regarding what to produce, the Government may produce those goods and services which are most useful for its society.
• Regarding how to produce, the most suitable technique in production is adopted whether labour intensive or capital intensive in accordance with the situation in the economy.
• Regarding for whom to produce, the goods and services are produced to help those people who are suffering from hunger or shortage though there is a loss.
• It gives importance to the quality of life rather than quantity of production.
• It focuses the resources on rapid economic development.

Question 2:
Write a short note on Market Economy.
Answer:
A Market Economy also known as Capitalistic Economy is that economy in which the economic decisions are undertaken on the basis of market mechanism by the private entrepreneurs. It functions on demand and supply conditions. In USA, Japan, Australia, UK and other countries we can see Market Economic systems.

In market economy, private individuals own the factors of production. Here, profit is the sole motive. There is least intervention by the Government.

Price mechanism plays a major role in market economy. It is a balancing wheel of the market mechanism. Prices coordinate decisions of the producers and consumers. The price is determined by demand and supply in the market. No individual organization or Government is responsible for the production and distribution or pricing of goods. All depend on market mechanism).

Regarding the basic problems of an economy, the problem of “What to produce”, is solved on the basis of demand and profit. The producers produce those products which bring more income.

The problem of “How the goods are to be produced”, is determined by the competition among different entrepreneurs. They select the least cost combination of technology so that they can get more returns with less cost.

In Market Economy, the/problem of “For whom to produce”, is decided on the basis of purchasing power of consumers. The producers produce commodities for the rich as they can afford to pay more but poorer sections of the society get neglected.

In Market Economy, profits and losses play a predominant role in growth and development of every producer.

Question 3.
Explain the nature of Mixed Economy. How does it differ from Market Economy?
Answer:
A Mixed Economy is that economy in which we can see co-existence of both private and public sector enterprises. It is the combination of Socialistic and Capitalistic features. The best example for this is India.

In a Mixed Economic system, the resources are owned by both the Government and Private individuals. Here, some areas of economic activities are totally governed by the Government and other sectors are open to the private sector also.

The Government involves in those activities which promote maximum social and economic welfare without any profit motive. The Private sector functions with the intention of maximizing profits. Here we find dual pricing system. For example, the supply of Rice through Government Fair Price shojis is low when compared to the private provision stores.

In this type of economy, the Government takes the responsibility to run certain essential sectors like Railways, Printing of currency notes, Atomic energy, public parks etc. Here, the basic problems are solved both by Public and Private Sectors.

Regarding what to produce,-consumers play a main role. But, the Government also interferes by imposing tax or giving subsidy. The problem of how to produce, the private sector will follow the least cost effective technology to maximize profit and public sector will select , the technology on the basis of composition of resources. The problem of for whom to produce depends on both the purchasing power of consumers and the Government policy towards weaker sections of society.

Mixed Economy	Market Economy
(i) It is that economy where we can see both Public and Private Sector functioning.	(i)It is that economy where we can see only Private sector operating.
(ii)Price mechanism do not play much role	(ii)Price mechanism plays a major role.
(iii)It is a partially restricted economy	(iii)It is free economy
(iv)Both Private and Public Sector leads the economy.	(iv)Private sector leads the economy
(v)It is both profit motive and welfare motive.	(v)It is profit motive only

Question 4.
Is Economics Positive or Normative? Discuss.
Answer:
Positive Economics .

1. The positive economics is the study of ‘what was’ and ‘what is’ under the given set of circumstances. It is concerned with how the economy performs the basic functions of what to produce, how to produce and for whom to produce. It explains how the economy takes decisions about consumption, production and exchange of goods.

2. It deals with the scientific explanation of the working of the economy. It analyses every issue of economics from a positive perspective without passing any value judgments. It deals with the cause and effect relationship of economic variables.

Normative Economics:

1.The Normative economics studies ‘what ought to be’. It explains about ‘what should be and should not be done’. Here we try to understand that whether the mechanisms are desirable ornot. The normative economic statements are sometime called matters of op.nion or statements of value.

2. The advice given by various economists are mostly as per normative economics.
In India, Economic Advisers who are appointed by the Government are responsible for advising the Prime Minister as to which of the policies are good and beneficial to the country’s economy and which are bad and detrimental on the whole.

Economics is both Positive and Normative:

1. But, Economics is both a positive and normative science. The study of economics involves both scientific investigation and policy analysis. Economists first use science to explain the world and understand how the economy works, later policies are explored for the economic development.

Question 5.
What method would you prefer to formulate an economic theory?
Answer:
Economic theories are statements of economic tendencies of people. While developing economic theories, the Economists formulate assumptions. So, economic theory derives generalizations of economic facts through two methods: They are as follows:

Deductive Method: This method was developed by David Recardo, J.S.Mill, T.R.Malthus, Alfred Marshall and others. This method is also called as Analytical method.

under this method, the conclusions are drawn from the universal to the individual or from general to the particular. This method derives new conclusions from assumptions. It is also called as ‘Scientific Method’. It includes four stages viz.,

• Identification of the hypothesis to be tested.
• Generations of predictions from the hypothesis.
• Conducting experiments to check whether the predictions are correct.
• Confirming the hypothesis.

Inductive Method: This method was advocated by Frederic List, Rosher and Hilde Brand. Inductive method is a process of reasoning from particular to general or from individual to the universal. It functions in four stages viz.,

•  Selection of an economic problem and defining the same clearly.
• Collection of data using statistical techniques.
• Analysing the data.
• Observation and generalization to establish a general truth.

The inductive method is also called as historical method or concrete method and realistic method. In this method, we investigate particular facts or historical events and try to generalize the findings of the observation for the entire economic system.

It is concluded that both Deductive and inductive methods are e^ntial for the proper development of economic laws. According to Alfred Marshall, “Induction and deduction are both needed for scientific thought just as the right and left foot are both needed for walking”.

Question 6.
Explain the various limitations of Micro Economics.
Answer:
Micro Economics is the study of the economic actions of individuals and small groups of individuals. According to Boulding, “ It is the study of particular firms, particular households, individual prices, wages, income, individual industries, particular commodities”.
The major limitations of Micro Economics are as follows:

(a) Assumptions are unrealistic: The study of Micro-Economics assumes that ‘other tilings being constant’, which is not realistic. In fact, all factors are subject to change and not constant.

(b) Micro Economics is an unrealistic analysis: Micro-Economics uses static analysis. The conclusions drawn from Micro Economic analysis are not valid. For example, individual savings is good since it promotes individual economic prosperity. But if many people indulge in savings, it may lead to a fall in demand leading to less investment and causing unemployment.

(c) The assumption of full employment is incorrect: The microeconomics is based on the assumption of full employment i.e., all the resources are completely employed in production process, which is just imaginary and not correct.

(d) Laissez-faire policy (Minimum intervention of Government): The assumption of laissez faire policy is not practical in real world, where we see intervention of Government in economic activities.

(e) Ignores Macro economic analysis: The knowledge of an entire economy is very essential to the people as it includes all the economic elements. But the micro economics concentrates only on a small part of the whole economy.

(f) It is limited in scope: The scope of micro economics is limited and narrow. It does not include income theory, inflation, monetary policies etc. which are very important for economic analysis.

2nd PUC Economics Introduction to Micro Economics Ten Marks Questions and Answers

Question 1.
Discuss the basic problems of an economy.
Answer:
An economic system or economy is a mechanism where the scarce resources are channelized . on priority to produce goods and services. These goods and services produced by all the sectors of the economy determine the national income.

Generally, human wants are unlimited and resources to satisfy them are limited. If there was a perfect match between human wants and availability of resources there would have been no scarcity, no problem of choice and no economic problems at all. So, one has to select the most essential want to be satisfied with limited resources. In economics, this problem is called ’Problem of Choice’.

The problem of choice arising out of limited resources and unlimited wants is called economic problem. In every economy whether developed or underdeveloped, Capitalistic, Socialistic or Mixed economy, there will be three basic economic problems viz., What to produce, How to produce and For whom to produce. Let us discuss them in detail.

(a)What to Produce: Every country has to decide which goods are to be produced and in what quantities. Whether more guns should be produced or more foodgrains should be grown or whether more capital goods like machines, tools, etc., should be produced or more consumer goods (electrical goods, daily usable products etc.) will be produced. What goods to be produced and in what quantity depends on the economic system of.the country. In Socialistic economy, the Government decides and in Capitalistic economy market forces decide and in Mixed economy, both the Government and market forces provide solutions to this problem.

(b) How to Produce: There are various alternative techniques of producing a product. For example, cotton cloth can be produced with either handloom or power looms. Production of cloth with handloom requires more labour and production with power loom use of more machines and capital. It involves selection of technology to produce goods and services.

There are two types of techniques of production viz., (a) Labour intensive technology and (b) Capital intensive technology.
The society has to decide whether production be based on labour intensive or capital intensive techniques. Obviously, the choice of technology would depend on the availability of different factors of production (land, labour, capital) and their relative prices (rent, wages, interest).

(c) For whom to produce: Another important decision with economy has to take is for whom to produce. The economy cannot satisfy all wants of an the people. Therefore, it has to decide who should get how much of the total output of goods and services. The society has to decide about the shares of different groups of people- poor, middle class and the rich, in the national output.

Apart from above, an economy also faces other problems: they are as follows:

(a) The problem of economic efficiency: The efficient utilisation of existing resources of an economy has also become a major problem. The Optimum use of both natural and human resources is needed to prevent the wastage of these resources.

(b) The problem of full employment: Full employment means utilisation of resources to the fullest extent. Under utilisation of human resources leads to unemployment, disguised unemployment etc. If the natural resources are not used to the maximum, there is a wastage of potentiality of an economy.

(c) The problem of economic growth: Every nation wants to increase its Gross Domestic Product to achieve economic growth. This in turn improves the standard of living and reduces poverty and unemployment. Every economy has to increase its ability to produce more goods and services with the help of existing resources in order to achieve economic growth. But many developing countries are facing this problem of economic growth. So, the above are the basic problems of an economy common to all the economic systems of the world.

Question 2.
Explain the main types of Economic Systems.
Answer:
The main types of economic system are:

1. Socialistic/Centrally Planned Economy
2. Capitalistic/Market Economy and.
3. Mixed Economy.

1. Centrally Planned Economy or Socialistic Economy.
A planned economy also called as socialistic.economy is that economy where the economic activities are controlled by the central Government. Here, the Government takes decisions about the allocation of resources in accordance with objectives to attain economic and social welfare. Example, Russia, China,
North Korea etc. Here, the basic economic problems are solved as follows:

Government takes decisions about the allocation of resources in accordance with the predetermined goals and objectives to attain maximum social welfare. Government decides what to produce, how to produce and what prices are to be fixed.

• Regarding what to produce, the Government may produce those goods and services which are most useful for its society.
• Regarding how to produce, the most suitable technique in production is adopted whether labour intensive or capital intensive in accordance with the situation in the economy.
• Regarding for whom to produce, the goods and services are produced with the welfare of people who are suffering from hunger in mind even though there may be a loss.
• It gives importance to the quality of life rather than quantity of production.
• It focuses the resources on rapid economic development.

2. Market Economy:
A Market Economy also known as Capitalistic Economy is that economy in which the economic decisions are undertaken on the basis of market mechanism by the private entrepreneurs. It functions on demand and supply conditions. In USA, Japan, Australia, UK and other countries we can see Market Economic systems.

In Market Economy, private individuals own the factors of production. Here, the profit is the main goal of business. There is the least intervention of Government.

Price mechanism plays a major role in Market Economy. It is a balancing wheel of the market mechanism. Prices coordinate decisions of the producers and consumers. The price is determined by demand and supply in the market. No individual organization or Government is responsible for the production and distribution or pricing of goods. All depend on market mechanism.

Regarding basic problems of an economy, the problem of what to produce is solved on the basis of demand and profit. The producers produce those products which bring more income.

The problem of how the goods are to be produced is determined by the competition among different entrepreneurs. They select least cost effective combination of technologies so that they can get more returns for their investment.

In Market Economy, the problem of for whom to produce is decided on the basis of the purchasing power of the consumers. The producers produce commodities for the rich who can afford to pay more but poorer sections of the society are neglected.

In Market Economy, profits and losses play a predominant role in the growth and development of every producer.

3. Mixed Economy:
A mixed economy is that economy in which we can see co-existence of both private and public sector enterprises. It is the combination of Socialistic and Capitalistic features. The best example is India.

In a mixed economic system, the resources are owned by both the Government and Private individuals. Here, some areas of economic activities are totally governed by the Government and other sectors are open to the private sector.

The Government involves in those activities which promote maximum social and economic welfare without any profit motive. The Private sector functions with the intention of maximizing profits. Here we find dual pricing system. For example, the supply of rice through Government Fair Price shops is low when compared to the private provision stores.

In this type of economy, the Government takes the responsibility to run certain essential sectors like Railways, Printing of currency notes, Atomic energy, public parks etc. Here, the basic problems are solved both by Public and Private Sectors.

Regarding what to produce, consumers play the main role. But, the Government also interferes by imposing tax or giving subsidy. The problem of how to produce, the private sector will decide the best cost effective technology to maximize profits and public sector will select the technology on the basis of composition of resources. The problem of for whom to produce depends on both the purchasing’power of the consumers and the Government policy towards weaker sections of the society.

Question 3.
Explain the uses of Micro-Economics.
Answer:
Micro Economics is the study of the economic actions of individuals and small groups of . individuals. According to Boulding, “The study of particular firm, particular household, individual price, wage, income, individual industry, particular commodity, is Micro Economics.”

Micro Economics is an important method of economic analysis. It has both theoretical and practical importance.

(a) Helpful in the efficient employment of resources-allocation of resources: Micro Economics deals with the economizing of scarce resources with efficiency. The principal problem faced by modern Governments is the allocation of resources among competing wants. In this sense, Micro Economics is used by the Government in the efficient employment of resources and achieving economic growth With stability.

(b) Helps in understanding the working of the economy: Micro Economics is of utmost importance in understanding the working of a free economy. In such an economy, there is no agency to plan and coordinate the working of the economic system. The decisions like how to produce, what do produce etc., are taken by producers mid consumers without any outside influence.

(c) Provide tools for economic policies: Micro economics provides analytical tools for evaluating the economic policies of an Economy. Price mechanism or market mechanism is the tool which helps us in this respect. Micro Economics thus helps in formulating correct price policies.

(d) Useful in understanding the problems of Taxation: The study of micro economics helps in understanding some of the problems of taxation. It is used to explain the welfare implications of a tax. It studies the distribution of incidence of a commodity tax (excise duty/sales tax) between sellers and consumers.

(e) Helpful in International Trade: In the field of international trade, it is used to explain the gains from international trade, balance of payments and the determination of the foreign exchange rate.

(f) Helps us to know Market structure: The study of Micro Economics is useful in understanding the different market conditions like perfect competitive market, monopoly, duopoly, oligopoly etc.

(g) Construction and use of economic models: Micro Economics constructs and uses simple models for understanding the actual economic phenomena. It helps not only to describe the actual economic situation, but also suggests policies that would bring in the desired results;

(h) The basis of predictions: Micro Economic theory can be used as the basis for prediction. This does not mean that it will enable us to predict the future. It will enable the user to make conditional predictions.

(i) Solution to the problem of choice: The study of Micro Economics helps to find solution to the problem of choice by providing various guidelines for proper allocation of scarce
resources.

(j) Helps business executives: Micro Economics helps the business executives in the attainment of maximum productivity with existing resources. It is with its help that one is able to know the consumer demands and calculate the cost of production.

(k) Helps in formulation of economic planning: In order to solve the basic problems of an economy, conscious planning is required. The knowledge of micro economics helps the members of National Planning Commission to frame aims and objectives based on the availability of resources.

(l) Expands intellectual capacity of Human mind:- The study of economics helps individuals to develop their thinking and intelligence to take appropriate decisions in their daily life.

(m) To examine the conditions of economic welfare: Micro Economics can be used to examine the conditions of economic welfare. Welfare economics is related to maximization of social welfare. The study of Micro Economics may be the greatest help in raising the standard of living of the population.

(n) Helps different sections of the society: The knowledge of Micro Economics is very important to know the different sections of the society like poor, middle class, rich, male and female population, skilled and unskilled labourers etc. It helps us to understand the problems of these sections and to arrive at proper Solutions.
Thus, Micro Economics is considered as an efficient method of problem solving.

You can Download Chapter 16 Environmental Issues Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 16 Environmental Issues

2nd PUC Biology Environmental Issues NCERT Text Book Questions and Answers

Question 1.
What are the various constituents of domestic sewage? Discuss the effects of sewage discharge on a river.
Answer:
Domestic waste – Waste that is produced from our homes and passed down into sewer system matter that floats . Effects of sewage on river.

Quality of water is decreased . So it becomes unsuitable for bathing, domestic uses etc.

B.O.D- [Biological oxygen demand] – More waste in water, more decomposers come into action, much larger amount of O₂ utilized so, B.O.D. increases and dissolved oxygen becomes less.

Question 2.
List all the wastes that you generate, at home, school or during your trips to other places, which you could easily reduce? Which would be difficult or rather impossible to reduce?
Answer:
Plastic containers, paper, electronic goods, leftover food, food package, disposable glasses, cup plates, polythenes, excreta, soap and detergent waste are the wastes that one can generate at home, school or during trips to other places. Yes, we can easily reduce waste through judicious use of material by changing our habits & lifestyles.
Out of these, polythene and plastic material are hard to dispose of off as they are non-biodegradable and can be recycled back.

Question 3.
Discuss the causes and effects of global warming. What measures need to be taken to control global warming?
Answer:
The greenhouse effect is the progressive, gradual warming of the earth’s atmosphere caused by the insulating effect of carbon dioxide and other greenhouse gases that have proportionately increased in the atmosphere. The greenhouse effect disturbs the way the earth’s climate maintains the balance between incoming and outgoing energy by allowing short-wave radiation from the sun to penetrate through to warm the earth but preventing the resulting long-wave infrared radiation from escaping back into the atmosphere. There is concern that increasing the concentration of greenhouse gases, including carbon dioxide, methane, and man-made chlorofluorocarbons, may enhance the greenhouse effect and cause global warming.
Effects of global warming are :

(i) Warming of the atmosphere will significantly increase its moisture carrying capacity. While the troposphere warms up, the stratosphere will cool down. This would cause extensive changes in precipitation patterns due to changing patterns of air-mass movements. Besides, the frequency of droughts, floods, etc., is estimated to increase substantially. Climate change will increase threats to human health, predominantly in tropical and subtropical countries, due to changes in ranges of disease vectors, water-borne pathogens, etc.

(ii) global warming may contribute to sea-level rise due to the thermal expansion of oceans as it warms, and the melting of glaciers and Greenland ice sheets. A rise of even half a meter in sea level would profoundly affect the human population, one-third of which lives within 60 km of a coastline. Numerous low-lying islands may be submerged. The inundation of coastal salt marshes and estuaries may deprive many important birds and fishes, their breeding grounds, forcing their extinction.
Strategies to deal with global warming:

• Complete replacement of chlorofluorocarbon with substitutes that have little effect on ozone and global warming.
• Increasing vegetation cover of forests for photosynthetic utilisation of CO₂.
• Reduction in use of nitrogen fertilisers and instead relying more on nitrogen fixation.
• Limiting use of fossil fuels by developing alternate sources of energy, e.g., solar energy, wind energy.
• Increasing use of alternative, renewable, nonpolluting sources of energy like solar energy, wind energy, hydropower etc.

Question 4.
Match the items given in column A and B:

Column A – Column B
(a) Catalytic converter – (i) Particulate matter
(b) Electrostatic – (ii) Carbon precipitator monoxide and nitrogen oxides
(c) Earmuffs – (iii) High noise level
(d) Landfills – (iv) Solid wastes
Answer:
(a) Catalytic converter – (i) Co & NO
(b) Electrostatic – precipitator (ii) Particulate matter
(c) Earmuffs – (iii) High noise level
(d) Landfills – (iv) Solid wastes

Question 5.
Write critical notes on the following:
(a) Eutrophication
(b) Biological magnification
(c) Groundwater depletion and ways for its replenishment.
Answer:
(a) Eutrophication: Eutrophication is the phenomenon of nutrient enrichment of a water body that initially supports a dense growth of plant and animal life. It is caused by run-off from fertilised fields, suburban lawns, feedlots, and detergent-rich sewage. Organic loading or occurrence of excess organic matter occurs inside water. The rapid growth of water plants especially the algae is called bloom. They cut off light from submerged plants and later die. This decreased oxygen putrefaction further decreases dissolved oxygen replenishment inside water. Blue-green algae present in the bloom also release toxins. Both toxicity and decreased oxygen level kill aquatic animals.

(b) Biological magnification: Biomagnification is due to the introduction of toxic substances from industrial and household waste into the aquatic food chain. The concentration of toxic substance accumulated by organism increases at each trophic level – Biomagnification, eg: Toxic substances like mercury, DDT, etc.
They later lead to eutrophication.

Birds (25 ppm)
↑
large fish (2ppm)
↑
small fish (0.5 ppm)
↑
zooplankton (0.04 ppm)
↑
water (0.003 ppm)
(DDT concentration showing biomagnification)

(c) Groundwater depletion and ways for its replenishment
Groundwater depletion – due to high demand of water in urban, hilly, arid areas where surface water is not available or polluted, groundwater is the major source of water drawn using tube wells, pumps etc., [in Punjab, T.N, Rajasthan]

Replenishment:

• Reduced consumption or stop using groundwater for irrigation and cleaning etc.
• Rainwater harvesting – Collection of rainwater and diverting them into the ground using pipes or into rivers or rainwater tanks. [As an alternate source of water also].

Question 6.
Why ozone hole form over Antarctica? How will enhanced ultraviolet radiation affect us?
Answer:
A large amount of ODS (Ozone Depleting Substances) like CFCs, N₂O, halons, SO₂, CH₄, Cl-are released by advanced countries like the USA, Japan, European countries. These are released in the stratosphere, drift towards poles, and reach there before the coming of winter. During winter (temp. 85°C) ice clouds are formed over Antarctica and no sunrise is received in polar areas. It catalyses the release of Cl from CFCs. With the coming of the spring season, Cl reacts with ozone in the presence of sunlight and converts 03 into 02 causing ozone depletion/thining of ozone shield in stratosphere called ozone hole. This hole disappears in summer due to the free mixing of air of Antarctica with there to the global air.

Effect of Enhanced UV Radiation:

• Snow blindness or inflammation of the cornea
• Damage of skin cells and development of skin cancer
• Damage to nucleic acids and proteins
• Reduced immunity
• A higher number of cataracts in humans.

Question 7.
Discuss the role of women and communities in the protection and conservation of forests.
Answer:
In 1731, a Bishnoi woman Amrita Devi showed exemplary courage by hugging a tree to prevent its cutting. Her three daughters and hundreds of other Bishnois followed her. They were killed by the soldiers of king of Jodhpur. This movement forced the king to abandon the cutting trees. Later ‘Chipko Movement’ was started by Sundar Lai Bahuguna and others to prevent the cutting of trees.

Question 8.
What measures, as an individual, you would take to reduce environmental pollution?
Answer:
The following initiatives can be taken to prevent environmental pollution:
Measures for preventing air pollution:

• Planting more trees.
• Use of clean and renewable energy sources such as CNG and biofuels.
• Reducing the use of fossil fuels.
• Use of catalytic converters in automobiles.

Measures for preventing water pollution:

• Optimizing the use of water.
• Using kitchen wastewater in gardening and other household purposes measures for controlling noise pollution:
  • Avoid burning crackers on Diwali,
  • Plantation of more trees.

Measures for decreasing solid waste generation:

• Segregation of waste.
• Recycling and reuse of plastic and paper.
• Composting of biodegradable kitchen waste.
• Reducing the use of plastics.

Question 9.
Discuss briefly the following:
(a) Radioactive wastes
(b) Defunct ships and e-wastes
(c) Municipal solid wastes
Answer:
(a) Radioactive Waste. They are nonusable discards which possess radioactivity. Radioactive wastes are of three types:

• Wastes with low-level radioactivity: Coolant water of atomic reactors and pond water used for cooling spent fuel contains a very small amount of radioactivity. This, however, undergoes biomagnification.
  Irradiation centres, radiotherapy units and laboratories also produce wastes with low-level radioactivity,
• Wastes with intermediate level radioactivity: They are radioactive wastes of many ores which are separated during refinement of minerals,
• Wastes with high-level radioactivity: Spent fuel of atomic reactors and leakage from reactors have very high level of radioactivity. All wastes with radioactivity have to be handled carefully and dumped 500 m deep in earth or inside sea after placing them inside very thick protective containers.
  Radioactive wastes are highly dangerous to human beings, animals, microbes and vegetation. They kill all of them. Loss of hair, nails appearance of deformities, cancers and genetic defects appear due to mutations.

(b) Defunct ships and e-wastes – Defunct ships also contribute to solid wastes. Such ships are broken down for scrap metal in developing countries like India. These defunct ships are the source of toxicants like asbestos, polychlorinated biphenyls, tributyltin, lead, mercury, etc. The workers get exposed to these chemicals and the coastal area in the vicinity of ship breaking yard gets polluted. Irreparable computers and other electronic goods are responsible for electronic wastes or e-wastes. Such wastes can only be buried in landfills or incinerated. Developed countries export the e-wastes to developing countries where metals like copper, iron, silicon, nickel and gold are recovered from e-waste by the recycling process. In the process, workers get exposed to these harmful toxic substances.

(c) Municipal solid wastes – Municipal solid wastes include domestic/kitchen wastes, market wastes, sweepings, wastes, from commercial complexes, rubbish, hospitals, slaughterhouses, livestock/poultry wastes, and trash like waste metals e.g., cans, plastic, pet bottles, polyethylene carry bags etc. Hospital wastes include vials, plastic and glass bottles, syringes, needles, organic wastes, chemicals and a lot of pathogen carriers. Hospital and domestic wastes are thus a source of a variety of pathogens. Municipal wastes are partly degradable and partly nondegradable. Burning reduces the volume of wastes although it is generally not burnt to completion and open dumps often serve as a breeding ground for rats and flies.

Question 10.
What initiatives were Jtaken for reducing vehicular air pollution in Delhi? Has air quality improved in Delhi?
Answer:
Delhi has been categorized as the fourth most polluted city in the world in a list of 41 cities. The burning of fossil fuels has added to the pollution of air in Delhi. Various steps have been taken to improve the quality of air in Delhi:

• Introduction of CNG (Compressed Natural Gas): By the order of the supreme court of India, CNG-powered vehicles were introduced at the end of the year 2006 to reduce the levels of pollution in Delhi. CNG is a clean fuel that produces very few unburnt particles.
• Phasing out of old vehicles.
• Use of unleaded petrol.
• Use of low-sulphur petrol and diesel.
• Use of catalytic converters.
• Application of stringent pollution-level norms for vehicles.
• Implementation of Bharat stage I, which is equivalent to euro II norms in vehicles of major Indian cities.
• The introduction of CNG-powered vehicles has improved Delhi’s air quality, which has lead to a substantial fall in the level of CO₂ and SO₂. However, the problem of Suspended Particulate Matter (SPM) and Respiratory.
• Suspended Particulate Matter (RSPM) still persists.

Question 11.
Discuss briefly the following :
(a) Greenhouse gases
(b) Catalytic converter
(c) Ultraviolet B
Question
Answer:
Greenhouse gases – are those gases which allow short wave radiations to pass through but absorb longwave heat radiations: eg: CO₂, CH₂, N₂O, CFCs.
They cause the greenhouse effect and increase surface temperature making the earth. Sustainable or life

Question Downward flux of long waves by greenhouse gases is called greenhouse reflux. It keeps the earth warm at 15°C, without it earth’s temperature would dropto-18°C.

But enhanced greenhouse effect causes global warming that is leading to deleterious changes in the environment and resulting in odd climate changes.

(b) Catalytic Converter : It is a method to reduce emissions from automobiles. The device has platinum-palladium, and Rhodium as catalyst. Exhaust emissions passes through it; nitric oxide splits into nitrogen and oxygen, Carbon monoxide into carbon dioxide, unburned hydrocarbons get burned to form CO₂ and H₂O. It is useful only is unleaded petrol because lead inactivates catalyst of the convertor.

(c) Ultraviolet B (UVB) – They normally do not reach earth’s surface as ozone layer reflects it back. But due to the ozone hole, UVB reaches earth surface these days.
They cause:

• Skin cancer
• Blinding – Corneal damage.
• Immune system is partially suppressed
• Larval stages die
• Photosynthesis – is impaired so crop yield falls.
• Nucleic acids – Mutations
• Phytoplankton – their function is disturbed so productivity falls.
• Global warning.

2nd PUC Biology Environmental Issues Additional Questions and Answers

2nd PUC Biology Environmental Issues One Mark Questions

Question 1.
Name two important methods to control air pollution from industries.
Answer:
Electrostatic precipitators and scrubbers.

Question 2.
What are the causes of air pollution?
Answer:
The causes of air pollution: The main causes of air pollutions are fossil fuels industries, factories, and particulate matter are produced due to the combustion of petrol, diesel, kerosene, etc. in vehicles, houses, and factories which pollute air.

In thermal power plants, steel and glass industries, paper and sugar mills etc. combustion of coal and furnace oil produce carbon monoxide, carbon dioxide, sulphur dioxide, ash, dust particles and some heavy metals which are released into atmosphere. Similarly, various types of chemicals released from cloth mills, cement industries, asbestos industries, pesticides, industries etc. also causes air pollution.

Question 3.
Two very serious inherent problems related to nuclear energy.
Answer:

1. Accidental leakage
2. Safe disposal of radioactive wastes.

Question 4.
What is an ozone shield or ozone layer?
Answer:
The region in the stratosphere where ozone is present in high concentration is called the ozonosphere or ozone layer or ozone shield.

Question 5.
What is ozone hole?
Answer:
The thinning of ozonal layer over the Antarctic region is called the ozone hole.

Question 6.
What is acid rain.
Answer:
It is the deposition of acidic chemicals of the atmosphere over the earth by combining them with rain droplets.

Question 7.
What constitutes smog.
Answer:
It is an opaque dark fog that is formed by smoke, dust, oxides of sulphur, nitrogen, H₂S, water vapour, etc.

Question 8.
Expand the term PAN and BOD, PPN. (CBSE 2005, 2007, 2008)
Answer:

• PAN – Peroxy acyl nitrate
• BOD – Biological oxygen demand
• PPN – Peroxy – propional nitrate.

Question 9.
High DDT pollution in water bodies causes a decline in the bird population. Evaluate.
Answer:
The high concentration of DDT disturbs calcium metabolism in birds, which causes thinning of eggshells and their premature breaking eventually causing a decline in bird populations.

Question 10.
What is Sonic Boom?
Answer:
It is a series of shock waves left behind by a supersonic Jet flying at a speed. It produced sudden rattling of windows and doors. Building many develop cracks.

Question 11.
Define biomagnification.
Answer:
It is the increase in the concentration of certain toxic chemicals like DDT at successive trophic levels through the food chain is called biomagnification.

Question 12.
What do you mean by eutrophication?
Answer:
It is defined as the nutrient enrichment in the water bodies leading to the depletion of oxygen and deadening of the life-supporting environment, due to slow ageing of water bodies.

Question 13.
How can you measure the amount of biodegradable organic matter in sewage water?
Answer:
It is possible to estimate the amount of biodegradable organic matter by Biochemical Oxygen Demand.

Question 14.
Name the world’s most problematic aquatic weed? What is the nature of water body in which this weed grows? (CBSE 2008)
Answer:
Eichhornia crassipes is the problematic aquatic weed grow in an eutrophied water body.

Question 15.
Expand CPCB..
Answer:
Central Pollution Control Board.

Question 16.
Define Pollutants.
Answer:
Those agents which bring undesirable change in the physical-chemical and biological characteristics of air, water and soil are called pollutants.

Question 17.
Write the main aim of the Environment Act in 1986 (pollution).
Answer:
“Protect and improve the quality of our environment i.e. air, water and soil”.

Question 18.
What is meant by the greenhouse effect?
Answer:
The greenhouse effect is a naturally occurring phenomenon, in which the short wave radiations of solar energy are absorbed and longwave radiations are reflected by the earth, but reabsorbed by certain gases and increases the temperature of the earth’s surface and atmosphere.

Question 19.
Between amphibians and birds, which will be able to cope with global warming? Give reason.
Answer:
Birds. Because they are warm-blooded animals can adjust the body temperatures as per the changes in the environment.

Question 20.
What gases cause stratospheric ozone depletion? What is the result of this depletion? (CBSE 2004)
Answer:
N₂O, CH₄, CO₂, chlorine are some of the gases that lead to ozone depletion. The depletion leads to the ozone hole which allows the entry of UV-B radiation to the earth’s surface. This radiation causes skin cancer, blindness, global warming etc.

Question 21.
What will be the consequences if the electrostatic precipitator of a thermal power plant fails to function?
Answer:
In the absence of an electrostatic precipitator, the particulate pollutants and gaseous pollutants of the exhaust will get into the atmosphere.

Question 22.
What is Snow blindness?
Answer:
Snow blindness is the inflammation of the cornea caused by a high dose of UV-B radiation.

Question 23.
Where did the Chipko movement start?
Answer:
In Garhwal Himalayas.

Question 24.
What is the Chipko movement?
Answer:
The movement led by Gaura Devi along with Sunder Lai Bahuguna of Tehri region of Uttara Khand to prevent the felling of trees by hugging the trees.

Question 25.
What JFM. What are its main objectives?
Answer:

• Joint Forest Management.
• Protection of Sal forest by local communities.

Question 26.
What ITS the main objective of the Montreal Protocol?
Answer:
Limiting production and consumption of chloroform carbon to half the level.

2nd PUC Biology Environmental Issues Two Marks Questions

Question 1.
What are major causes of soil erosion?
Answer:

• Over Cultivation
• Poor irrigation practices
• Deforestation
• Unrestricted grazing.

Question 2.
What is Montreal Protocol? What is its aim?
Answer:
Montreal Protocol is an international treaty, that was signed in Montreal (Canada) in 1987 and become effective in 1989. The main .aim is to control the emission of ozone-depleting substances.

Question 3.
Waterlogging can increase soil salinity. Discuss.
Answer:
Waterlogging draws salt to the surface of the soil. This salt is then deposited as a thin crust on the land surface and starts collecting roots of the plant.

Question 4.
Mention the harms caused by fine particulates in humans.
Answer:

• They may be inhaled deep into the – lungs and cause breathing and respiratory problems.
• Irritation of lungs.
• Inflammation of lungs.
• Premature death.

Question 5.
How is letting of sewage into water bodies cause fish mortality?
Answer:

• As the sewage is discharged into water bodies, there is an increase in biodegradable organic matter.
• The microorganisms multiply fast with the increase in organic matter, which Is used as its substrate for them.
• These microbes consume a lot of oxygen and there is a sharp decline in the dissolved oxygen content of the water body, this leads to fish mortality.

Question 6.
Differentiate between biodegradable and nonbiodegradable waste.
Answer:

• Biodegradable: These are the waste which can be broken down into simpler harmless substances by the activity of decomposers. These substances are used as manures.
• Non-biodegradable: The substances which cannot be broken down into simpler substances by microbes and start accumulating in the biosphere.
• This causes pollution and can lead to biomagnification.

Question 7.
Write an account on Ecosan -Ecological sanitation.
Answer:

• Ecological sanitation is a sustainable system for handling human excreta, using dry composition toilets.
• This is a practical, hygienic, efficient, and cost-effective solution to human waste disposal.
• In this method, human excreta can be recycled into manures that reduce the need for chemical fertilizers.
• There are working eco sans in Kerala and Srilanka.

Question 8.
How is organic farming advantageous?
Answer:

• This allows maximum utilization of resources.
• It increases the efficiency of production.
• There is no need for chemical fertilizers for crops, as cattle excreta, can be used as manures.
• Crop wastes are also decomposed and used as manures.
• Cattle dung and crop wastes are used to generate biogas, which is used for cooking and lighting.

Question 9.
How is the greenhouse effect caused?
Answer:

• The atmospheric gases absorb half of the incoming solar radiation and heat the earth’s surface.
• Earth surface re-emits the heat in the form of infrared radiation.
  A large part of this is absorbed by greenhouse gases (CO₂, CH₄, N₂O, CFCs etc).
• The molecule of these gases radiate heat energy back into the atmosphere and the earth’s surface is heated up once again.
• This cycle is repeated a number of times and there is an increase in the global temperature.

Question 10.
Differentiate between “Good ozone” and “Bad ozone”.
Answer:

Good ozone	Good ozone
Good ozone refers to the ozone found in the stratosphers.	Bad ozone refers to the ozone found in the troposphere.
It absorbs UV radiations and protects the living organisms of the earth.	This is harmful to plants and animals.

Question 11.
Mention any 3 reasons for deforestation.
Answer:
Deforestation is caused due to human activation for the following purposes.

• Forests are cleared for making homes and industries due to overpopulation.
• Forests are converted into agricultural land to produce food for increasing population.
• Trees are fell for timber, firewood and other uses.

Question 12.
Write preventive measures to control air pollution.
Answer:
Measures for the control of air pollution :

• Industrial smokes must be filtered before releasing them into the atmosphere.
• Tree plantation should be increased and deforestation prevented.
• The use of automobiles should be minimized which reduce the nitrogen contents in the atmosphere.
• The use of crude fuels should be avoided and use of high-quality fuels should be recommended.
• Nuclear explosions should be avoided.
• Legal control of air pollution.
• Plantation of air-purifying plants.
• Development of parks and gardens in cities.

Question 13.
Define pollution. Compare the biodegradable and non-biodegradable pollutants.
Answer:
Pollution is an undesirable change in the physical, chemical or biological characteristics of air, water and land that may harmfully affect human, animal and plant life and may destroy our valuable resources. Pollutants are broadly classified into biodegradable and non-biodegradable. Pollutants, which decompose rapidly by natural processes are called biodegradable pollutants (e.g. market garbage, livestock wastes, municipal sewage etc). Non-biodegradable pollutants are the materials that either do not degrade or degrade only very slowly in nature (e.g. DDT, BHC, waste plastic bottles, polyethylene bags, used soft drink cans etc).

Question 14.
What does BOD indicate? What is its relationship with the dissolved oxygen content of the water body?
Answer:
BOD is Biological oxygen demand which is a measure of the oxygen required by aerobic decomposers for the degradation of biodegradable organic matters in the water bodies.
If BOD is higher, it indicates the high level of organic matter and vice versa.

2nd PUC Biology Environmental Issues Three Marks Questions

Question 1.
Mention the harmful effects of noise on human health.
Answer:

• Sleeplessness and headache
• Noise level of 150 dB or more than these can cause permanent hearing impairment
• Increased heart beating and blood pressure
• Difficulty in breathing
• Stress and strain

Question 2.
Describe the particular type of agriculture practiced in northeastern states of India which has also contributed to deforestation. What is it commonly called?
Answer:
Slash and Burn agriculture is practiced in the north-eastern states of India.
In this method, the farmers cut down the trees of the forest and burn them and clear a certain area for farming.

The ash is used as manure and the land is used for the cultivation of crops or grasses for cattle grazing. ‘After cultivation for a period of time, the land is left free for several years to allow its recovery The farmers move to a different area in the forest and this process is repeated. This practice is commonly called Jhum Cultivation.

Question 3.
It has been recorded that the temperature of the earth’s atmosphere has increased by 0.6°C.
a. What has caused this increase?
b, Explain its consequences.
Answer:
a. Increase in the level of greenhouse gases has led to considerable heating of earth leading to global warming. The temperature of the earth has increased by 6°C, most of it during the last three decades.

b. The rise in temperature is leading to deleterious changes in the environment and results in odd climatic changes, thus leading to increased melting of polar ice caps as well as of other places like the Himalayan snowcaps. This will result in a rise in sea level that can submerge many coastal areas

Question 4.
The figure given aside shows the relative contributions of various greenhouse gases to total global warming.

Answer:
(i) Name the gases a and b.
(ii) Explain how an increase in greenhouse gases in the earth’s atmosphere leads to the melting of the caps.
Answer:
(i) (a) N₂O
(b) CH₄
(ii) Increase in greenhouse gases (GHGs) results in increased greenhouse flux or trapping long wave radiations and sending them back to earth. It increases atmospheric temperature called global warming. High atmospheric temperature results in the melting of ice caps and glaciers.

Question 5.

The above diagram shows a simplified biogeochemical cycle.
(a) Name the compound whose cycle is deposited
(b) In what way do vehicles add this compound to the atmosphere?
(c) What adverse effect does excess have on the environment?
(d) Cite an event that depicts this effect in modern times.
(e) Suggest 2 ways of reducing this effect.
Answer:
(a) CO₂ cycle
(b) By burning fossil fuel
(c) Global Warming
(d) Melting of glaciers and a slow rise in sea level, submerging of low-lying islands.
(e)

• Limiting the use of fossil fuels
• Increase the vegetation cover

Question 6.

Study the graph and answer the following questions
(1) What is the relationship between dissolved oxygen and biochemical oxygen demand (BOD)
(2) Mention their effect on the aquatic life of the river.
Answer:

1. The dissolved oxygen content is inversely proportional to BOD i.e. when BOD rises, the content of dissolved oxygen decreases and vice versa.
2. When BOD is high, the aerobic aquatic organism will die due to decreased availability of dissolved oxygen.
3. When BOD is low, the content of dissolved oxygen becomes high. In clear water, aerobic aquatic organisms reappear.

2nd PUC Biology Environmental Issues Five Marks Questions

Question 1.
Differentiate between Biological magnification and eutrophication. (CBSE2007)
Answer:

Biological Magnification	Eutrophication
(a) It is increasing the concentration of a persistent pollutant With the rise in trophic level.	It is the nutrient enrichment of a water body.
(b) It occurs both in terrestrial and aquatic ecosystem	Occurs only in the aquatic ecosystem
(c) There is no excessive growth	There is excessive growth of algae
(d) Organic loading is absent	Organic loading occurs in the water body.
(e) The higher-order consumers are harmed most.	The whole aquatic ecosystem is damaged.

Question 2.
Given below are the sources of pollution and their effects. Using this information, fill the spaces in the given box. Each pollutant may have more than one source and may show more than one effect. Pollutant source: Automobile exhaust, Burning of fossil fuels, refrigerant, the agricultural field, lire extinguisher, paint solvents, Deforestation, plastic foam.
Effect: Photochemical smog, Acid deposition, global warming, Depletion of ozone.
Answer:

Name of pollutant	Source	Effect
CFC Suspended particulate matter (SPM) Oxides of nitrogen Sulphur dioxide Methane (CH4)

Answer:

• CFC: Sources – Refrigerant, Fire extinguisher, paint solvents, plastic foam.
  Effects: Depletion of ozone, global warming
• SPM: Sources – Automobile exhaust, Burning of fossil fuel
  Effect: Photochemical smog.
• Oxides: Source-Automobile exhaust, Burning of nitrogen of fossil fuel, Agricultural field.
  Effect: Photochemical smog, Acid-deposition, global warming.
• Sulphur dioxide: Source – Automobile exhaust, Burning of fossil fuel.
  Effect: Acid deposition.
• Methane Sources: Agricultural field, Burning of fossil fuel.
  Effect: global warming.

Question 3.
Differentiate between
(a) BOD and COD
(b) Montreal and Kyoto protocols.
Answer:
(a) BOD and COD

BOD	COD
(i) It is biochemical oxygen demand	It is chemical oxygen demand.
(ii) Its value is lower	Its value is higher
(iii) It measures oxygen demand for the completion of degradation of organic matter.	It measures oxygen demand for oxidizing all the red­uced substances, whether organic or inorganic.
(iv) It employs decompose microbes	It employs potassium permanganate or potassium dichromate.

(b) Montreal and Kyoto protocols.

Montreal Protocol	Kyoto protocols
(i) It is related to a reduction in the production and consumption of CFC and other ODS.	It is related to the emission of CO2 and other greenhouse gases
(ii) The protocol was signed in 1987	(ii) This was signed in 1997
(iii) It was followed by Helsinki decla­ration to phase out CFCs and halons. The road map was prepared to help the actions to replace CFC and ODS.	(iii) It has been followed by the Bati conference in 2007 Road map has been prepared to reduce the emission of greenhouse gases by 2012.

(a) What is meant by deforestation? Mention the cause of it.
(b) Why is CNG preferred to diesel/petrol
Answer:
It is the conversion of forest areas to non-forest areas and ultimately to a desert.
(a) Causes of deforestation are

• Conversions of forest land to agricultural land to produce food for the increasing population.
• Cutting of trees for timber and wood
• Jhumcultivation in the north-eastern states of India
• Forest fires.

(b)

• CNG burns most efficiently in automobiles and leaves very little of it unburnt.
• CNG cannot be adulterated like petrol/diesel
• It cannot be siphoned by thieves
• It is cheaper than petrol/diesel.

Question 4.
Write the effects of noise pollution.
Answer:
Effects of Noise pollution:

• The more acute and immediate effect of noise pollution is impairing of hearing leading to auditory fatigue and may finally lead to deafness.
• Interference with speech communication.
• Noise pollution leads to neurosis, anxiety hypertension, cardiovascular disease, hepatic stress, giddiness.
• Annoyance leading to ill-temper, bickering, mental disorientation, and violent behaviour.
• The high intensity of noise pollution can cause blood vessels to contract, skin becomes pale, muscles to contract, and adrenaline to be short into the bloodstream with consequence rise in blood pressure. This ultimately results in tension and nervousness.
• Affects different metabolic activities.

You can Download Chapter 14 Ecosystem Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 14 Ecosystem

2nd PUC Biology Ecosystem NCERT Text Book Questions and Answers

Question 1.
Fill in the blanks.

1. Plants are called as _________ because they fix carbon dioxide.
2. In an ecosystem dominated by trees, the pyramid (of numbers) is _________ types.
3. In aquatic ecosystems, the limiting factor for productivity is __________
4. Common detritivores in our ecosystem are _____________
5. The major reservoir of carbon on earth is _______________

Answer:

1. Producers
2. Spindle
3. light
4. Earthworms ants and mites
5. Oceanic.

Question 2.
Which one of the following has the largest population in a food chain?
(a) Producers
(b) Primary consumers
(c) Secondary consumers
(d) Decomposers
Answer:
(d) Decomposers can have a maximum number but not included in the food chain.
So (a) Producers is the answer.

Question 3.
The second trophic level in a lake is-
(a) Phytoplankton
(b) Zooplankton
(c) Benthos
(d) Fishes
Answer:
(b) Zooplankton

Question 4.
Secondary producers are
(a) Herbivores
(b) Producers
(c) Carnivores
(d) None of the above
Answer:
(a) Herbivores

Question 5.
What is the percentage of photosynthetically active radiation (PAR), in the incident solar radiation?
(a) 100%
(b) 50 %
(c) 1-5% .
(d) 2-10%
Answer:
(b) 50%.

Question 6.
Distinguish between
(a) Grazing food chain and detritus food chain
(b) Production and decomposition
(c) Upright and inverted pyramid
(d) Food chain and Food web
(e) Litter and detritus
(f) Primary and secondary productivity
Answer:
(a) Grazing food chain and detritus food chain

Grazing food chain	Detritus food chain
1. Also known as Predator-prey food chain.	1. Also known as Saprotrophs food chain.
2. It is a common food chain where producers are eaten by herbivores, herbivores by carnivores, and the latter by higher-order carnivores. Eg: Grass→ grasshopper → frog →Snake → Vulture.	2. It proceeds from dead bodies and organic remains. Eg: Decaying plant matter → earthworm-) bird →Snake → Vulture.
3. It binds the inorganic nutrients into organic matter.	3. It releases the inorganic nutrients bound up in the organic matter.
4. It adds organic matter to detritus food chain	4. Provides inorganic nutrients to grazing food chain.

(b) Production and decomposition

Production	Decomposition
1. It is the pheno­menon of synthesis of fresh biomass. 2. It locks up inor­ganic nutrients into the biomass. 3. It traps energy.	1. It is the pheno­menon of degra­dation of waste organic matter. 2. It releases inor­ganic nutrients from the organic matter into the environment. 3. It releases energy.

(c) Upright and inverted pyramid

Upright pyramid	Inverted pyramid
It is the ecological pyramid where the producers form a broad base and the consumers keep decreasing (in energy number or biomass)	It is the ecological pyramid, where the producers form a narrow base while the consumers keep increasing (in number of biomass)

(d) Food chain and Food web

Food chain	Food web
1. Food chain refers to the transfer of energy from the producers through a series of organisms. 2. It is less realistic in nature	1. A number of interconnected food chains constitute a food web. 2. It is more realistic in nature.

(e) Litter and detritus

Litter	Detritus
1. Freshly fallen parts of plants dead parts of plants, and animals and faecal matter of animals that haven’t strapped to decompose, constitute litter.	1. Freshly fallen and dead parts of plants and animals and faecal matter that have started to decompose constitute detritus.

(f) Primary and secondary productivity

Primary productivity	Secondary productivity
1. It is the rate at which matter is built up by producers. 2. It is due to photosynthesis 3. There is a net gain of the energy in the biosphere	1. It is the rate at which matter is built up by consumers. 2. It is due to herbivores and predation. 3. There is no such activity

Question 7.
Describe the components of an ecosystem.
Answer:
The components of an ecosystem can be divided into two categories: biotic and abiotic.
(i) Biotic components:
(i) Producers – Green plants which can synthesize their own food.
(ii) Consumers – They do not synthesize their food. They may be
-Primary consumer/herbivores – consuming plants as food.
-Secondary and tertiary consumers or carnivores – They feed on either herbivores or carnivores.
(iii) Decomposers – These organisms breakdown the dead bodies or waste products of plants and animals into simpler inorganic compounds.
(2) Abiotic components:
(i) Climatic components
•Light
•Temperature
•Wind
•Atmospheric gases
•Rain
•Atmospheric humidity
(ii) Soil factors
•Organic materials
•Minerals
•Soil, water
•Soil air
(iii) Topographic factors
•Altitude
•Direction and steepness slope

Question 8.
Define ecological pyramids and describe with examples, pyramids of number and biomass.
Answer:
Ecological pyramids They are the graphical representations of the various ecological parameters at the successive trophic levels of food chains with producers at the base top carnivores at the apex and intermediate levels .in between. Quantity at each level is indicated by the length of the bar in the graph. The pyramids are therefore also called bar diagrams.

Pyramids of number:
It is a graphical representation of the numerical strength of various populations in different trophic levels per unit area of an ecosystem with producers forming base intermediate levels forming intermediate tiers and apex formed by top carnivores length of the bar at each trophic level is proportional to the number of individuals at this level.

Pyramid of biomass
Biomass is the amount of living matter measured in terms of fresh or dry weight. Dry weight is preferred as it avoids seasonal variations in the moisture content of biomass.

The pyramid of biomass is the graphical representation of the amount of biomass per unit area sequence-wise in rising trophic levels with producers at the base and top carnivores at the apex. Length of the bar indicates the comparative amount of biomass at that trophic level. Biomass is maximum in producers. Only 10% to 20% biomass is passed from producer level to herbivore level.

Question 9.
What is primary productivity? Give a brief description of factors that affect primary productivity.
Answer:
Primary productivity is the amount of biomass or organic matter produced per unit area over a time period by plants during photosynthesis. It is expressed in terms of weight (g/m²/yr) or energy (kcal/m²/yr). It is of two types: gross primary productivity and net primary productivity. The Gross primary productivity of an ecosystem is the rate of production for organic matter during photosynthesis. Gross primary productivity minus respiration losses (R), is the net primary productivity (NPP).

Factors affecting primary productivity are as follows:

• Solar radiation: Maximum light is available in the tropics. Poles receive minimum light. Due to this, photosynthesis is maximum and net primary productivity (NPP) is highest (> 20 t ha^-1 year^-1) in tropics against (8 t ha^-1 year^-1) in temperate forests.
• Temperature: Temperate forests have lesser productivity (about 8 t ha^-1 year^-1) than tropical rain forests (20 t ha^-1 year^-1) due to the cold climate.
• Moisture: Rain and humidity increase the productivity of the ecosystem.
• Nutrients: Nutrients are essential for the producer’s growth. Desert soils are deficient in nutrients and therefore, are less productive.
• Photosynthetic efficiency of producers: C₄ plants are more productive than C₃ plants.

Question 10.
Define decomposition and describe the processes and products of decomposition.
Answer:
Decomposition is the process of breaking down a substance into its constituent parts. It is a complex, enzymatic process that involves step-wise degradation of detritus. It involves three steps- fragmentation of detritus, leaching, and catabolism involving humification and mineralization. Humification results in the formation of humus in the soil. Mineralization results in the release of inorganic substances (CO₂, H₂O) and nutrients in the soil.

Question 11.
Give an account of energy flow in an ecosystem.
Answer:
Energy flow:- The passage of energy through various trophic levels of an ecosystem is called energy flow. Their is no circulation of energy. Instead unidirectional flow of energy occurs in the ecosystem.

(1) Capture of energy:- Under favorable conditions, 1-5% solar radiation is captured by producers and used for photosynthesis. It is gross primary productivity some 20% this is used by producers in their own activities. The net primary productivity is available to herbivores. 8-4% of incident radiations.

(2) Transfer to herbivores:- Herbivores get a part of net primary productivity. The remaining is changed into detritus which is a source of energy for decomposers. Herbivores waste a lot of food energy during ingestion about 30% food energy is used up by herbivores for their life activities and liberated as heated. The remaining is used in building biomass of herbivores. It is about 10% of the productivity of producers. The transfer of about 10% of biomass energy from one tropic level to the next tropic level is called 10% law (ten percent law).

(3) Transfer to Primary carnivores:- Host of the herbivores are eaten by primary carnivores. Lots of energy wastage occurs during the predation. About 60% of assimilated food energy is used up by primary carnivores for their external activities. The rest amount of the energy is transferred to Secondary carnivores.

(4) Transfer of energy to higher-level carnivores:- 10% of biomass energy available at the level of primary carnivore becomes incorporated into biomass of secondary carnivores. If there is a still higher level carnivore, it uses 10% of biomass energy present at the level of secondary carnivores. As energy available at higher carnivore level becomes small, an ecosystem doesn’t have more than 3-5 trophic levels. eg….

Question 12.
Write important features of a sedimentary cycle in an ecosystem.
Answer:
In the sedimentary cycle materials involved in circulation between biotic and abiotic components of the biosphere are non-gaseous and the lithosphere is the reservoir pool, e.g., phosphorus, calcium, and magnesium. Sulphur has both sedimentary and gaseous phases. Sedimentary cycles are slow and less perfect as compared to gaseous cycles.

Question 13.
Outline salient features of carbon cycling in an ecosystem.
Answer:
Carbon is the most abundant element as it occurs in every organic substance. It forms 49% of the dry weight of organic matter. Carbon occurs as free carbon dioxide in the atmosphere and dissolved as CO₂ in the hydrosphere. Carbon dioxide is being added to the cycling pool of the atmosphere and hydrosphere through two processes, biological and non-biological.

Biological- All living organisms produce carbon dioxide through respiration Carbon trapped in organic matter is released as CO₂ during its decomposition.
Non-Biological – Combustion or burning of biomass and fossil fuels produce carbon dioxides.

2nd PUC Biology Ecosystem Additional Questions and Answers

2nd PUC Biology Ecosystem One Mark Question

Question 1.
Define ecosystem.
Answer:
An ecosystem is a functional unit of nature, where living organisms (biotic) interact among themselves and also with the abiotic factors or their physical environment.

Question 2.
By observing the relationship between the first pair, write the missing word.
a. Plants : producers :: Animals : ……………..
b. Food chain : food web :: Ecosystem : ……………………
Answer:
a. consumers
b. biosphere

Question 3.
What is the net primary productivity of an ecosystem? (CBSE Delhi 2005)
Ans:
It is the rate of energy stored or biomass accumulated by the producers. It depends upon the rate of photosynthesis as well as respiration.

Question 4.
What PAR?
Answer:
The part of incident solar radiation that can be absorbed and used by plants autotrophs for photosynthesis, is called photosynthetically active radiation (PAR).

Question 5.
Explain consumers of ecosystems.
Answer:

1. Producers: All the green plants.
2. Consumers: Depends on others for food.
   • Primary consumer: Depends on plants called herbivores.
   • Secondary consumers: Depends on herbivores for food.
   • Tertiary consumers: Depends on secondary consumers.
3. Decomposers: They decomposed dead organic matter.

Question 6.
What does the detritus food chain begin with?
Answer:
Detritus food chain begins with dead organic matters.

Question 7.
Why type of nutrition is shown by decomposers?
Answer:
Saprophytic nutrition.

Question 8.
What term is given to the inter-connected food chain?
Answer:
Food-web.

Question 9.
What do mean by “Ten percent law”?
Answer:
Ten percent law states that only 10% of the energy is transferred from one trophic level to the next trophic level through food chain.

Question 10.
Identify the type of ecological pyramids shown here?
Answer:

• Pyramid of number in a tiee ecosystem.
• Pyramid of biomass in an aquatic ecosystem.

Question 11.
What do you mean by ecological succession?
Answer:
It is the phenomenon of gradual and fourly predictable changes in the species composition of a given area leading ultimately to the establishment of a climax community.

Question 12.
Define the term “Sere1
Answer:
The entire sequence of communities that successively change and lead to the establishment of a climax community is called a sere.

Question 13.
Define the term ‘climax community”?
Answer:
The community that is in near equilibrium with the environment, and does not undergo much change and occupied a large area is called climax community.

Question 14.
What do you mean by ‘Pioneer species’?
Ans:
The species that invades a bare area and starts establishing a community is called pioneer species.

Question 15.
Name the pioneer species
(1) On a bare rock
(2) In a water body (CBSE foreign 2008)
Answer:

1. Lichen
2. Phytoplankton.

Question 16.
What is the structure and composition of a community expected to remain unchanged?
Answer:
Un disturbed climax community

Question 17.
In the pyramid of biomass given below, name 2 types of crops
(i) One which is supported and
(ii) One which supports. In which ecosystem such type of pyramids found.

Answer:
(i) primary producer (phytoplankton)
(ii) primary consumer (zooplankton)
In aquatic ecosystem such type of pyramid found.

Question 18.
Give an example of an inverted ecological pyramid, what kind of pyramid of energy would it have?
Answer:
Inverted ecological Pyramid Pyramid of numbers based on a large tree as a producer supporting a number of herbivorous birds each having a number of parasites.

2nd PUC Biology Ecosystem Two Marks Questions

Question 1.
In the following table the ecological units are mentioned in the first column vertically and their attributes are mentioned horizontally. Match the ecological unit and its attribute and put a tick mark in the blanks with the table

Answer:

Question 2.
Match column A with any two of column B

Answer:

Question 3.
Differentiate between primary succession and secondary succession. (CBSE 2006)
Answer:

Primary succession	Secondary succession
(1) It occurs in biologically sterile areas.	(1) Occurs in an area which is biologically quite fertile
(2) Humus/organic matter is absent in the early stages	(2) Present from the very beginning.
(3) It begins on a soilless area.	(3) Occurs on an area having sufficient soil.
(4) It takes a long time ie. 1000 years and more.	(4) It takes place in lesser time 50-200 years.

Question 4.
Differentiate between standing crop and standing state (CBSE 2008)
Answer:

Standing crop	Standing state
(1) It is the amount of living matter or biomass of biotic components of an ecosystem.	(1) It is the amount of inorganic nutrients present in an ecosystem.
(2) It is present all over the ecosystem.	(2) It occurs in the growth medium of producers.
(3) It indicates the productivity of the ecosystem.	(3) It determines the productivity of the ecosystem.

Question 5.
Mention four functional aspects of in ecosystem.
Answer:
The four functional aspects of an ecosystem are

• Productivity
• Decomposition
• Energy flow
• Nutrient cycling.

Question 6.
Define Productivity? How is it expressed?
Answer:
Productivity refers to the rate of biomass production.
It is expressed as g^-2 yr^-2 or (Keal m^-2) yr^-1

Question 7.
Differentiate between gross primary productivity and net primary productivity.
Answer:

Gross Primary Productivity (GPP)	Net Primary Productivity (NPP)
It is the rate of produ­ction of biomass/organic matter by producers during photosynthesis	It refers to the biomass or organic matter available at the producer level to the primary consumers i.e. GPP (Respiration losses)

Question 8.
Write the factors which determine primary productivity.
Answer:
Primary productivity depends on

• The photosynthetic capacity of the plant species.
• Availability of nutrients
• Amount of sunlight available
• Water availability and temperature.

Question 9.
What would happen to the successive trophic levels in the pyramid of energy, if the rate of reproduction of phytoplankton was slowed down? The suggestion in phytoplankton reproduction. (CBSE Delhi 2006)
Answer:
As phytoplanktons are the producers in the ecosystem, the amount of energy available for transfers will decrease. Organisms at successive trophic levels will also decrease. ‘
The two factors responsible for the reduction in the phytoplankton population are

• Low nutrients and
• Less availability of oxygen.

Question 10.
Distinguish between standing crop and standing state.
Answer:

• Standing crop: Each trophic level has a certain mass of living material at a particular time. This is called a standing crop.
• Standing state: The amount of nutrients such as carbon, nitrogen, phosphorus, calcium, etc. present in the soil at any given time is called a standing state.

Question 11.
Differentiate between Hydrarch succession and Xerarch succession

Hydrarch succession	Xerarch succession
1. The ecological succession that starts in water bodies and proceeds to mesic condition is called hydrarch succession 2. Phytoplantation from the pioneer community.	1. The ecological succession, that starts With bare rocks xeric conditions and proceeds to mesic condition is called  Xerarch succession. 2. Lichens form the pioneer community.

Question 12.
The climax community of every succession is not isolated with one or two species of organisms.’ Justify.
Answer:
The climax community of every succession is the forest. It is a stable community. The community organization becomes more complex in the climax community. A large number of plant and animal species occur in a forest.

Question 13.
Differentiate between the carbon cycle and phosphorus cycle
Answer:

Carbon cycle	Phosphorus Cycle
1. The reservoir of the carbon cycle in the atmosphere as carbon dioxide and also the lithosphere, as fossil fuel. 2. There is the respiratory release of CO2	1. The reservoir of the phosphorus cycle is the phosphate-containing rocks of the lithosphere. 2. There is no respiratory release of phosphorus.

Question 14.
Differentiate between production and decomposition
Answer:

Production	Decomposition
1. It is the process of the formation of biomass or organic matter from a simpler inorganic substance 2. It occurs at the level of producers and consumers.	1. It is the process of the breakdown of larger organic molecules into simple molecules and ultimately into inorganic substances. 2. It occurs at the level of decomposers.

Question 15.
When is the structure and composition of a community expected to remain unchanged?
Answer:
The climax community remains stable as long as the environment remains unchanged. With time the xerophytic habitat gets converted into a mesophytic.

Question 16.
Differentiate between the Gaseous and sedimentary cycle.
Answer:

Gaseous cycle	Sedimentary Cycle
1. The reservoir of the gaseous cycle lies in the atmosphere 2. Exchange occurs in the form of gases between the living and nonliving comp­onents of the ecosystem.	1. The reservoir of the sedimentary cycle lies in the lithosphere. 2. Exchange occurs mainly in the form of dissolved nutrients between the non-living and the living components.

Question 17.
In the terrestrial ecosystem, the detritus food chain (DFC) and the grazing good chain (GFC) become interlinked. Justify the above statement. What term is given to such interconnection? (HOTS)
Answer:

• Certain organisms of the GFC are predators to certain animals of DFC. As a result, the food chains become interconnected.
  eg. earthworms which are detrivores are eaten by small birds (DFC) which become prey to vultures/kites or even cats of the GFC.
• Organisms like cockroaches and cows, which are omnivores play an important role in the interconnections of the food chain constitute a food web.

2nd PUC Biology Ecosystem Three Marks Questions

Question 1.
Describe the factors that control decomposition?
Answer:
Decomposition is controlled by
(i) Chemical composition of detritus

• Decomposition is faster when detritus is rich in nitrogen and water-soluble substances like sugars.
• Decomposition is slow when detritus is rich in lignin and chitin.

(ii) Temperature and soil moisture, through their effects on the activities of microbes.

• Warm and moist environment favour decomposition.
• Low temperature and absence/reduced moisture levels inhibit decomposition.

(iii) Oxygen

• Decomposition is an oxygen-consuming process
• Anaerobic condition inhibits decomposition.

Question 2.
Represent schematically the decomposition cycle in a terrestrial ecosystem
Answer:

Question 3.
What is humus? Mention its properties.
Answer:
Humus is a dark coloured, amorphous substance produced by the process of humification during the decomposition of detritus.
Properties of humus:

• It is highly resistant to microbial action and undergoes decomposition at an extremely slow rate.
• Being colloidal in nature, it serves as a reservoir of nutrients.
• It improves the water holding capacity of the soil.
• Further decomposition of it provides inorganic nutrients to the plants.

Question 4.
A given species may occupy more than one trophic level in the same ecosystem at the same time. Explain with an example (2008)
Answer:
A snake eating a mouse in a field/lawn occupies the third trophic level in the food chain.
Plants → Mice → Snake
When the snake eats a frog in the same field, it occupies the 4th trophic level in a food chain it is because the frog feeds on some of the insects which depend on the plants.
Plants → Insects → Frog → Snake
Thus in the same ecosystem, one animal (snake) occupies more than one trophic level at the same time as it cannot satisfy its food need from one trophic level.

2nd PUC Biology Ecosystem Five Marks Question

Question 1.
(a) Mention 2 human activities that affect the carbon cycle
(b) What are the different ways in which CO₂ is added to the atmosphere?
(c) How does the chemical nature of detritus determine the rate of decomposition.
Answer:
(a) The major human activities that influence the carbon cycle are

• Burning of fossil fuels.
• Deforestation

(b) CO₂ is added to the atmosphere in the following ways:

• Burning of fossil fuels
• Volcanic activity
• Forest fire
• Respiratory activities

(c)

• If the detritus is rich in lignin and chitin the decomposition is slow.
• If the detritus rich in nitrogen and water-soluble substances like sugars, decomposition is faster.

Question 2.
Explain the different steps in the process of decomposition.
Answer:

• Fragmentation:- It is the process of breaking the detritus into smaller particles by detrivores like earthworms.
• Leaching:- It is the process in which water-soluble inorganic substances rundown into soil horizon and get precipitated as salts.
• Catabolism:- The enzymatic conversion of the detritus into simple organic compounds and then into inorganic compounds is called catabolism. The enzymes are secreted by the decomposers like bacteria and fungi.
• Humification:- Humification during decomposition leads to the accumulation of a dark coloured amorphous substance called, humus.
• Mineralization:- It is the process in which the humus is degraded by certain microorganisms and the inorganic nutrients are released.

Question 3.
Describe the pond as an ecosystem.
Answer:

• A pond is a fairly self-sustainable unit that shows even complex interactions of an aquatic ecosystem.
• It is a shallow water body in which all the major/basic components of an ecosystem are well exhibited.

The abiotic components include

• Water with all the dissolved inorganic and organic substances.
• The rich soil deposits at the bottom.
• The solar input.
• The cycle of day length and temperature
• Other elematic factors.

The biotic components include.

• The producers or autotrophic components include phytoplankton, some algae, floating, submerged, and marginal plants.
• The consumers represented by zooplanktons free-swimming animals, bottom-dwelling animals, etc.

Question 4.
Show schematically the energy flow through different trophic levels of an ecosystem.
Answer:

You can Download Chapter 13 Organisms and Populations Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 13 Organisms and Populations

2nd PUC Biology Organisms and Populations NCERT Text Book Questions and Answers

Question 1.
How is diapause different from hibernation?
Answer:

Diapause	Hibernation
(i) Dormant stage in development of an organism	(i) State of inactivity in a mature organism.
(ii) Occurs in summers and winters	(ii) Only during winters
(iii) Reduction in free water	(iii) No such adaptations

Question 2.
If a marine fish is placed in a freshwater aquarium, will the fish be able to survive? Why or why not?
Answer:
If a marine fish is placed in a freshwater aquarium, the fish will not be able to survive because of osmoregulation problems. The marine fish is adapted to live in saline water, so, if it is kept in freshwater, it will not be able to cope with the outside hypotonic environment and it would face death.

Question 3.
Define phenotypic adaptation. Give one example.
Answer:
Phenotypic adaptations are non-genetic changes occurring in living organisms due to various extreme environmental conditions, such as stress, extreme temperature, change of habitat. These include acclimatization, behavioural changes, etc.

Question 4.
Most living organisms cannot survive at temperatures above 450C. How are some microbes able to live in habitats with temperatures exceeding 1000C?
Answer:
Archaebacteria (Thermophiles) are ancient forms of bacteria found in hot water springs and deep-sea hydrothermal vents. They are able to survive in high temperatures because their bodies have adapted to such environmental conditions. These organisms contain specialized thermo-resistant enzymes, which carry out metabolic functions that do not get destroyed at such high temperatures unlike other enzymes.
Most living organism can not survive above 45° because:

• Above 45° C enzymes get denatured
• Protoplasm precipitates at high temperatures.

Question 5.
List the attributes that populations but not individuals possess.
Answer:
the population has some attributes which are not shown by its individual members. An individual born and dies, whereas the population has a birth rate (natality) and a death rate (mortality). Each population has certain characteristics, such as age distribution, genetic composition, growth models. An individual is either male or female but a population has a sex ratio.

Question 6.
If a population growing exponentially double in size in 3 years, what is the intrinsic rate of increase (r) of the population?
Answer:

Question 7.
Name important defence mechanisms in plants against herbivory.
Answer:
There are various defence measures for animals against predators. But plants, as they cannot move away, have certain defence mechanisms against herbivory. Their main defences are chemical toxins, such as strychnine, a poison produced by tropical vine, morphine by opium poppy, nicotine produced by tobacco plant. Apart from these chemicals, the common defence measure is presence of spines (modified leaves) on the leaves, stems of the plant, modifications of leaves into thorns, development of sharp silicated edges in leaves which prevent them from damage caused by herbivores.

Question 8.
An orchid plant is growing on the branch of the mango tree. How do you describe this interaction between the orchid and the mango tree?
Answer:
An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them. Therefore, the relationship between a mango tree and an orchid is an example of commensalisms, where one species gets benefited while the other remains unaffected. In the above interaction, the orchid is benefited as it gets support while the mango tree remains unaffected.

Question 9.
What is the ecological principle behind the biological control method of managing pest insects?
Answer:
The ecological principle behind the biological control method of managing pest insects is a predator-prey relationship. It is based on the ability of the predator to regulate the prey population.

Question 10.
Distinguish between the following:
(a) Hibernation and Aestivation
(b) Ectotherms and Endotherms
Answer:

Hibernation	Aestivation
(i) Condition of passing the winter in a resting or dormant condition.	(i) State of inactivity during hot and dry summer.
(ii) Animal rests in a warm place	(ii) Animal rests in a cool, shady, moist place.
(iii) Lasts for the whole winter.	(iii) Lasts for the hot dry day because nights are often cooler

(b)

Ectotherms/Cold Blooded	Entotherms/Warm Blooded
(i) Unable to regulate their body temperature.	(i) Able to regulate their body temperature.
(ii) Lives in areas with favourable body temperature as they change their body temperature with respect to environmental temperature	(ii) Live in all places as there is only little effect on their body temperature by environmental temperature.
(iii) They show hibernation, aestivallon and are less active.	(iii) More active and no such inactive states are expressed

Question 11.
Write a short note on
a. Adaptations of desert plants and animals
b. Adaptations of plants to water scarcity
c. Behavioural adaptations in animals
d. Importance of light to plants
e. Effect of temperature or water scarcity and the adaptations of animals.
Answer:
(a) Desert plants have developed various adaptations to increase absorption of water and to reduce water loss. They have well developed root system that penetrates deep into soil surface to absorb water, leaves have thick waxy covering and are mostly reduced into spines to reduce rate of transpiration. Stems are green (carry out photosynthesis) and fleshy (to store water and mucilage). Animals in arid areas have the ability to tolerate dry conditions. During daytime desert animals move to burrows and seldom come out. They minimize loss of water by producing dry feces and concentrated urine. Some of them have special physiological adaptations to cope with scarcity of water and hot arid desert conditions. E.g., kangaroo rat seldom drinks water and 90% of its water requirements are met from metabolic water produced by respiratory breakdown of fats. Likewise, camel does not sweat till body temperature rises upto 55° – 66°C. Its body cells are capable of tolerating upto 40% dehydration, etc.

(b) The xerophytes have special adaptations to withstand prolonged period of drought. These are of four types – ephemerals (drought escapers), annuals (drought evaders), succulents (drought resistants) and non-succulent perennials (drought endurers). Ephemerals are xerophytes which evade dry conditions by remaining in the form of seeds but live for a brief period and complete their life cycle during the rains. Common examples are Euphorbia prostrata, Tribulus terrestris, etc. Annuals are the xerophytes which continue to live for a few months even after rains in hot dry conditions. They have modifications to reduce transpiration. A common example is Echinops echinatus. Succulents have fleshy organs to store large amounts of water. Plants like Opuntia, Euphorbia, Asparagus have fleshy stems which are green and photosynthetic. Non-succulent perennial plants have many morphological modifications to withstand dry conditions. These have an extensive root system that spreads deep in the soil and may reach water table to absorb the maximum amount of water. They also possess waxy coatings or hairs on leaves, sunken stomata, reduced leaf blades etc. to reduce transpiration, Examples include Acacia nilotica, Calotropis procera, etc.

(c) Some organisms show behavioral adaptations to cope with variations in their environment. E.g., desert lizards. They lack the physiological ability that mammals have to deal with high temperature. They keep their body temperature fairly constant by behavioral means. They enjoy in the sun and absorb heat when their body temperature drops below the comfort zone, but move into shade when the surrounding temperature starts increasing. Some species are capable of burrowing into the soil to hide and escape from too much heat.

(d) Light is the visible part of the electromagnetic spectrum. It is an important ecological factor as it affects different physiological processes of plants, e.g., photosynthesis, transpiration, movements, flowering, seed germination, etc.

• Photosynthesis: Light is essential for photosynthesis. The amount of photosynthesis depends upon the quality, intensity and duration of light.
• Growth: It is favoured by increased availability of food, moderate light intensity and red light. UV radiations favour rosette habit in plants. Blue light favours moderate but normal growth.
• Transpiration: Stomata generally open in light and close in darkness. Because of it light promotes transpiration. Transpiration is further enhanced by heating effect of light.
• Germination: A number of seeds are sensitive to light. They are called photoblastic seeds. Positively photoblastic seeds germinate only in the presence of light, e.g., Vtscum, Lactuca, Rumex.
• Movements: Small photosynthetic organisms show positive phototaxis in moderate light, e.g., Chlamydomonas, Euglena, Volvox. Plant shoots bend towards the source of light. It is positive phototropism. Flowers of some plants open or close in response to light and darkness.
• Photoperiodism: Different plants require different periods of light for flowering which is known as photoperiod and the response of the plant to photoperiod in terms of flowering is called photoperiodism.

(e) Animals facing water scarcity have ability to tolerate arid conditions and reduce water loss. For example kangaroo rat seldom drinks water; 90% of its water needs are met from v metabolic water i.c., water produced by respiratory breakdown of fat and the remaining 10% is fulfilled from food. It is nocturnal in habit and seldom comes out of its burrow during the daytime. It has a thick body covering to minimise water loss due to evaporation. The kangaroo rat excretes nearly solid urine and faeces. Another example is that of camel, commonly called the ‘ship of desert’. Camel being very economical in water consumption, tolerates fluctuations in temperature, maintains blood stream moisture with body cells capable of tolerating extreme heat stress, does not sweat till body temperature rises to 55°-66°C, produces dry faeces and concentrated urine. During periods of non-availability of water, the animal does not produce urine and stores urea.

Question 12.
List the various abiotic environmental factors.
Answer:

• Atmospheric factors: Light, temperature, wind and water.
• Lithosphere: Rock, soil.
• Hydrosphere: Pond, river, lake and ocean.
• Edaphic factors: Soil texture, soil water, soil air, soil microorganism, soil pH, minerals.
• Topographic factors: Slope, altitude, valley.

Question 13.
Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of benthic zone
Answer:
(a) An endothermic animal – Monkey (mammal)
(b) An endothermic animal Frog (amphibian), snake (reptile)
(c) An organism of the benthic zone – Angle Fish

Question 14.
Define population and community.
Answer:
The population can be defined as the total number of individuals of a species or any other class of an organism in a defined area or habitat or a group of individuals of the same species within a community.
The community can be defined as a naturally occurring assemblage of species living within a defined area or habitat.

Question 15.
Define the following terms and give one example for each:
a. Commensalism
b. Parasitism
c. Camouflage
d. Mutualism
e. Interspecific competition
Answer:
(a) Commensalism is the interaction between two living individuals of different species in which one is benefited while the other is neither harmed nor benefited except to a negligible extent. For example, the pilot fish (Naucrates) always accompanies the shark without getting attached to its body. It feeds on falling pieces of food when the shark is eating the prey.

(b) Parasitism is an interaction between two living organisms of different species in which one organism called a parasite obtains its food directly from another living organism called the host. The parasite spends a part or whole of its life on or in the body of the host. Thus it is an interaction between two individuals wherein the parasite gets the benefit at the expense of the host.

(c) Camouflage (Cryptic appearance) is the ability to blend with the surrounding or background. It is the most common type of adaptation by animals to remain unnoticed for protection or aggression. Camouflage is protective to animals which are preyed upon by others. It is advantageous in predation for predators like praying mantis (Mantis religiosa) which are green coloured, resembling a thin stem, and remain unnoticed till the prey comes within their striking range.

(d) Mutualism is an interaction between two species in which both species benefit. (The term symbiosis is often used synonymously with mutualism.) A well-known example of mutualism is the association between termites and the specialized protozoans that inhabit their guts. The protozoans, unlike the termites, are able to digest the cellulose of the wood that the termites eat and release sugars that the termites absorb. The termites benefit by being able to use wood as a foodstuff, while the protozoans are supplied with food and a suitable environment.

(e) In interspecific competition two or more populations usually belonging to the same trophic level or feeding habit compete with one another for the available natural resources. For example, in a forest area trees, shrubs, herbs, and vines compete with one another for sunlight, nutrients, water, pollinators, and dispersal agents.

Question 16.
With the help of a suitable diagram describe the logistic population growth curve.
Answer:

Logistic growth occurs because of natural selection. Here nature selects the filter (Survival of the fittest). Nature has resources to support a maximum number of people (Carrying Capacity (K)) beyond which resources won’t support them due to their lock. This explains that the log-phase follows a phase of acceleration. So we get the sigmoid curve.

This growth is Verhulst-pearl Logistic Growth
\(D=\frac { dN }{ dt } =rN\left( \frac { K-N }{ K } \right) \)

N=Population density at time
K = Carrying capacity
r = Intrinsic rate of natural increase

Question 17.
Select the statement which explains best parasitism.
(a) One organism is benefited.
(b) Both the organisms are benefited.
(c) One organism is benefited, other is not affected.
(d) One organism is benefited, other is affected,
Answer:
(d) Parasitism is an association of two organisms of different sizes and species in which one is benefited and the other is harmed. The organism which is benefited is called a parasite, and the organism that suffers is termed host. The parasite is weaker and smaller than host and gets nourishment and often shelter also from the host. The host can live without the parasite, but the parasite cannot survive without the host.

Question 18.
List any three important characteristics of a population and explain.
Answer:
The three important characteristics of a population are:

1. Population density: The number of individuals of a species per unit area, or a volume is called population density.
P_D=\(\frac { N }{ s }\)

Where, P_D = Population density
N = Number of individuals in a region
S = Number of a unit area in a region.

2. Birth rate: It is expressed as the number of births per 1000 individuals of a population per year.

3. Death rate: It is expressed as the number of deaths per 1000 individuals of a population per year.

2nd PUC Biology Organisms and Populations Additional Questions and Answers

2nd PUC Biology Organisms and Populations One Mark Question

Question 1.
Define the term ecology.
Answer:
It is the study of the relationships of living organisms with the biotic and abiotic components of the environment.

Question 2.
Name the factors essential for the formation of major biomes
Answer:

• The annual variation in the intensity and duration of temperature
• The annual variation in precipitation accounts for the formation of major biomes.

Question 3.
Which one of the two stenothermals or eurythermal, shows a wide range of distribution, on earth and why? (CBSE 2008)
Answer:
Eurythermal shows a wide range of distribution as they can tolerate and thrive in a wide range of temperatures.

Question 4.
Between amphibians and birds, which will be stable to cope with global warming? (AI2008)
Answer:
Birds will be stable because they are eurythermal, which can tolerate a wide range of temperatures.

Question 5.
Why many freshwater animals cannot live for long in seawater or vice versa. (Delhi 2008)
Answer:
This is because of the osmotic changes in the body.

Question 6.
Define homeostasis
Answer:
It is the self-regulatory mechanism to maintain the internal environment constant despite changes in the external environment.

Question 7.
How do herbs and shrubs survive under the shadow of big canopied trees in the forest? (AI 2008)
Answer:
They are adapted to photosynthesis optimally under very low light conditions and hence survive under the shadow of big canopied trees.

Question 8.
Why is the polar region not a suitable habitat for tiny hummingbirds? (AI 2008)
Answer:
The small birds have a larger surface area to body volume ratio and tend to lose heat fast when it is cold outside; consequently, they have to spend more energy to generate body heat.

Question 9.
Define the term migration
Answer:
Migration is the temporary, long-distance, or short-distance movements of animals from the stressful movement to a less stressful or comfortable environment and returns to the original habitat when the stressful period is over.

Question 10.
Define the term hibernation.
Answer:
It is the process in which animals spend the winter in an inactive/dormant state,
eg: Frogs, the polar bear.

Question 11.
When and why do some animals (frog, polar bear) go into hibernation (Delhi 2008)
Answer:
When the animals (like frogs) are not able to migrate from unfavorable or stressful conditions/habitats during the very cold conditions, they hibernate to avoid the stress by escaping in time.

Question 12.
Define the term aestivation?
Answer:
It is the process in which animals spend the dry, hot summer period in an inactive state,
eg: Snails.

Question 13.
When and why do some animals undergo aestivation?
Answer:
When the snails are not able to migrate from stressful habitats in summers they undergo aestivation to avoid stress by escaping in time.

Question 14.
Define the term adaptation.
Answer:
The development of certain features in an organism in response to a particular environment which may improve the chances of survival is called adaptation.

Question 15.
What is Allen’s rule?
Answer:
Allen’s rule refers to the minimising of heat loss in animals by possessing shorter ears and limbs.

Question 16.
Why do people living at high altitude have a higher red blood cell count or total hemoglobin
Answer:
To compensate for the low atmospheric pressure and low oxygen content of air prevailing at high attitudes, people have higher, RBC count or total haemoglobin.

Question 17.
List any 2 physiological responses that help you to gradually get acclimatized to high altitudes when you go from the plains (Delhi 2008)
Answer:

• Increasing in breathing rate
• Decreasing in binding capacity of haemoglobin.
• Increase in RBC production.

Question 18.
Define Population density.
Answer:
The total number of individuals of a species present per unit area or volume at a given time.

Question 19.
Give an example where population estimation of an organism is done indirectly without actually counting the organism. (AI2008)
Answer:

• The number of fish caught in a trap indicates the total population density in a lake
• The tiger census is based on the pug marks or faecal pellets.

Question 20.
When does a population growth curve become sigmoid?
Answer:
Sigmoid growth curve represents logistic growth where growth is slow initially and then becomes rapid the curve becomes steady due to resources become tending.

2nd PUC Biology Organisms and Populations Two Marks Questions

Question 1.
Why is thermoregulation more effectively achieved in larger animals than in smaller ones?
Answer:
Larger ones achieve thermoregulation more effectively than smaller ones because of less surface area/volume ratio in larger ones, hence lose body heat slowly.

Question 2.
Name the specialty of any population.
Answer:
Any population has some specialty these are:

1. Population density
2. Growth rate
3. Death rate
4. Age distribution
5. Biotic capacity
6. Population growth form
7. Changes of population
8. Population dispersion.

Question 3.
Study 3 representative figure of age pyramids

(a) Mention names were given to the 3 kinds of age profiles (i), (ii), (iii).
Answer:
(i) Expanding population (Triangular)
(ii) Stable population (Bell-shaped)
(iii) Declining population (Cube-shaped)

(b) Which one of them is ideal for the population and why?
Answer:
We take a stable population pyramid as ideal because our aim is to stabilize the population.

(c) How do such age profile studies help policymakers get concerned about the growing population?
Answer:
Age pyramid/profile can indicate

• Rate of growth of population
• Increase in the elderly population and reproductive-aged people.

These features help prepare for future planning on:

• The stress of family planning
• To help elderly and needful people to live comfortably.

Question 4.
(a) Write eg: for Verhulst Pearl logistic growth
Answer:
\(\frac { dN }{ dt } =rN\left( \frac { K-N }{ K } \right) \)
r=intrinsic rate of natural increase
N = Population density at time (t)
K = Carrying capacity.

(b) Draw graph for a population whose population density has reached the carrying capacity.
Answer:

(c) Why is the logistic growth model considered a more realistic one for most animal populations?
Answer:
The logistic growth model is considered realistic in animals because each area has a carrying capacity beyond which environmental resistance grows and restricts their growth. It decreases natality and increases mortality.

(d) Draw a growth curve where resources are not limiting the growth of the population?
Answer:

Question 5.
In adjacent population growth curves

Answer:
Curve (a) – Non-limiting
curve (b) – Limiting and has reached carrying capacity.

(ii) In absence of predators which curve will be demonstrated?
Answer:
Curve (a) because of the absence of a controlling factor.

Question 6.
Write the differences:

1. Species and Population
2. Population growth and Population density
3. Mono-specific and Polyspecific Population
4. Competition and Scattering.

Answer:

1. Species and Population: Population on defined as organisms that belong to identical species and identical geographical niche or area. The said area should enable these species to interbreed with each other.
2. Population growth and Population density: In biology, Population growth is the increase in the number of individuals in a population but the population density is a measurement of population per unit area, it is a quantity of type number density.
3. Monospecific or Polyspecific population: Monospecific population is the population of individuals of only one species but the polyspecific or mixed population is the population of individuals of more than one species and it is generally referred to as a community.
4. Competition and Scattering: Competition is in general a contest between two or j more rivalry between two or more entities, organisms, animals, economic groups or social groups, etc. Population scattering is a method which shows equilibrium by the interaction of population. In population, scattering seeds away from the parent plant.

Question 7.
List any two adaptive features evolved in parasites enabling them to live successfully on their hosts. (Delhi 2008)
Answer:
The adaptive features of parasites include

• Loss of unnecessary sense organs
• Presence of adhesive organs or suckers to cling on to the host.
• Loss of digestive system
• High reproductive capacity.

Question 8.
Explain, The formation of new species.
Answer:
Although all life on earth shares various genetic similarities, only certain organisms combine genetic information by sexual reproduction and have offspring that can then successfully reproduce. Scientists call such organisms members of the same biological species.

Question 9.
Write the influence of temperature on the life of the organism.
Answer:

• The temperature affects the enzyme reaction in the bur body.
• The thermal tolerance of organisms determines their geographical distribution.

Question 10.
Differentiate between Euryhaline and ‘ Stenohaline animals.
Answer:
Euryhaline animals Animals which can tolerate a wide range of salinity. Stenohaline animals Animals which can tolerate a narrow range of salinity.

Question 11.
What is the effect of light on the life of animals?
Answer:

• Intensity and duration of light influence the activities like foraging, migratory activities, and reproduction.
• light influences the temperature and thereby the metabolism of animals.

Question 12.
How does human beings maintain constant body temperature?
Ans:

• In summer we sweat profusely; the evaporation of the sweat cools the body and brings the body temperature down.
• In winter, we shiver and that produces more heat, to raise the body temperature.

Question 13.
Mention 2 adaptations the mammals of the colder regions have, to minimize the loss of body heat.
Answer:

• Mammals of colder regions have shorter ears and limbs.
• Aquatic mammals of colder seas have a thick layer of fat called blubber below the skin which acts as an insulator reduces the loss of body heat.

Question 14.
Differentiate between Population Size and Population Density.
Answer:

• Population size: The number of individuals of a species, in a given area at a given time.
• Population density: The number of individuals of a population per unit area at a given time.

Question 15.
Biomass is a more meaningful measure of population size. Explain.
Answer:

• If the population is huge, the total number is not as easily adaptable measure as the counting takes a very long time or counting becomes practically impossible.
• For some ecological investigations, there is no need to know the absolute population size/density.

Question 16.
Define carrying capacity.
Answer:
Carrying capacity is the maximum number of individuals of a population that can be sustained by a given habitat.

Question 17.
What is the role of predators in maintaining species diversity in an ecosystem?
Answer:
Predators help in maintaining species diversity in an ecosystem or community by reducing the intensity of competition among the competing prey species.

Question 18.
In what ways the prey species are adapted to escape from predators? Explain with example.
Answer:

• Some species of frogs and insects are cryptically coloured or camouflaged to avoid being detected easily by predators.
• Some prey species are poisonous and are avoided by the predators.

Question 19.
(a) How is Cuscuta adapted to be a parasitic plant?
(b) Why do cattle avoid browsing on Calotropis plants? Explain. (CBSE foreign 2009)
Answer:
(a)

• Cuscuta has no chlorophyll and leaves.
• It develops haustoria to derive nutrition from the host its parasites.

(b) Calotropis plants possess a highly poisonous cardiac glycoside, which is fatal to animals.

Question 20.
Name two basic types of competition found amongst organisms. Which one of these is more intense and why?
Answer:
The two types of competitions are

• Interspecific competition and
• Intraspecific competition

This intraspecific competition is more intense because it is an interaction among individuals of the same species for similar requirements.

Question 21.
Explain interference competition with an example.
Answer:
In interference competition, even if the resource is abundant, the feeding efficiency of one species is reduced by the interfering and inhibitory presence of other species.
Eg: The Abingdon tortoise in Galapagos islands become extinct within a decade due to the introduction of a goat on that island.

Question 22.
Differentiate between commensalism and Amensatism.
Answer:

• Commensalism:- It is the interspecific interaction in which one species is benefited while the other is neither benefited nor affected.
• Amensatism:- It is an interspecific interaction in which one species is affected, while the other species is neither benefited nor affected.

Question 23.
What is resource partitioning? Give an example.
Answer:
It is the phenomenons in which two species competing for the same resource could avoid competition by choosing different patterns of foraging and different times of feeding. Eg:- Five closely related species of warblers living on the same tree has been shown to co-exist and avoid competition by behavioural differences.

Question 24.
Give the interaction present in each.

1. The cuckoo lays her eggs in the crow’s nest
2. Orchid grows on a mango tree
3. Cuscuta growing on a shoe flower plant
4. Clownfish living among the tentacles of sea anemone
5. Ticks live on the skin of dogs
6. Mycorrhizae living on the roots of higher plants
7. Sea anemone is often found in the shells of hermit crab (CBSE-Delhi 2008)

Answer:

1. Brood parasitism
2. Commensalism
3. Commensalism
4. Commensalism
5. Parasitism
6. Commensalism
7. Commensalism.

Question 25.
Name and explain the interaction between fig trees and certain species of wasps.
Answer:
The interaction between fig trees and certain species of wasp is the mutualism.

• The female wasp uses the ovary of flowers as a site of oviposition (egg-laying) and the developing seeds as a flood for the larvae.
• The flower is pollinated when the wasp is searching a place for oviposition.

Question 26.
What type of interaction is there between clownfish and sea anemone. Why? (AI 2008)
Answer:
The interaction between clownfish and sea anemone is commensalism. In this, one is benefitted and the other is neither benefitted nor harmed.
In this relation
(i) The sea anemone has stinging tentacles which keep away the predators of clownfishes in this clownfish are getting benefit and the sea anemone is not getting any benefit or not harmed.

Question 27.
\(D=\frac { dN }{ dt } =rN\left( 1-\frac { N }{ K } \right) \)
(a) Which type of growth curve does it represents,
(b) What do the following notations represent
(i) \(\frac { dN }{ dt } \) (ii) r (iii) N (iv) K (CBSE 2005)
Answer:
(a) It represents logistic or Verhulst-Pearl logistic growth
(b) \(\frac { dN }{ dt } \) = rate of change in population size
r – intrinsic rate of natural increase
N – Number of existing individual
K – Carrying capacity.

Question 28.
Study the population growth curves shown in the diagram.

(1) Identify curves ‘a’ and ‘b’
(2) Mentions the conditions responsible for the curves ‘a’ and ‘b’ respectively
(3) Give the equation for the curve ‘b'(CBSE 2006)
Answer:
(1) a – Exponential curve
b – logistic or sigmoid curve

(2)
a – Unlimited food and other resources
b – Limited food and other resources

(3)
\(\frac { dN }{ dt } =rN\left( \frac { K-N }{ K } \right) \)

Question 29.
Study the table given below in regard to population interactions and the questions given below.

[(+) plus – beneficial interaction; (-) minus – detrimental interaction; 0 (zero) – neutral interaction.
(a) Identify the interactions a to e
(b) Explain each one. (CBSE 2008 comptt)
Answer:
A – B
(a) Amensalism – Species A harmed species B unaffected
(b) Predation/parasitism – Species A benefited species B harmed
(c) Competition – Species A and B mutually inhibited
(d) Mutualism – Both A and B benefitted
(e) Commensalism – Species A is benefitted Species B is unaffected.

Question 30.
Is the statement in correctly matched ? If it is incorrect, rewrite the correct form Camoflague: An organism showing resemblance with external environment animals or plants for the purpose of protection
Answer:
Incorrect:- Camoflague is blending with the background or surroundings due to similar colours, shape, or marketing so as to remain unnoticed by predators (for protection) and prey (advantage).

2nd PUC Biology Organisms and Populations Three Marks Questions

Question 1.
What are Conformers? Why they haven’t evolved mechanisms for temperature regulation or osmoregulation.
Answer:
Conformers are that organism, which change their body temperature, osmolarity etc. according to the external ‘environmental conditions.
(1) During the course of evolution, the costs and benefits of maintaining a constant internal environment are taken into consideration, when it is not advantageous, the organisms have not evolved mechanisms to maintain homeostasis.

(2) Heat loss or gain is a function of surface area and hence very small animals are not found in polar region i.e. they have become distributed according to the external conditions.

(3) Similarly aquatic animals, that are conformers can change the osmolarity of their body fluid according to the surroundings.

Question 2.
Explain population fluctuation.
Answer:
Population is generally a group of individuals of a particular species occupying a particular area at a specific time.
Population fluctuation: Any increase or decrease in number of individuals in a population from its equilibrium state is known as population fluctuation. It may occur due to various reasons, such as due to change in climate or due to change in physical environment or due to predators.

Question 4.
What do you mean by biotic community? Describe characteristic features of any biotic community.
Answer:
Biotic community: A biotic community is a localized association of several populations of different species living in a given geographic area of habitat. It represents heterogeneous assemblage of different groups of organisms both plants and animals. Biotic community is composed of smaller units of intimately associated members belonging to different species.

The different species of a community share a common environment and their relationships are based on direct or indirect functional interactions. The nature of the relationship is determined by the requirements of the members of a community.

Characteristics of a community: Each community has its own characteristics which are not shown by its individual component species.

1. Species diversity: Each community is made up of many different organisms: Plants, animals, microbes, which differ taxonomically from each other. The number of species and population abundance in the community also vary greatly.
2. Growth form and structure: Each community has a definite growth form. This different growth form determines the structural pattern of a community.
3. Dominance: In each community, all the species are not equally important. There are relatively only a few of these, which determine the nature of the community. These few species exert a major controlling influence on the community. Such species are known as dominants.
4. Succession: Each community has its own development history. It develops as a result of a directional change in it with time.
5. Trophic structure (Self-sufficiency): Nutritionally, each community, a group of autotrophic plants as well as heterotrophic animals exists as a self-sufficient, perfectly balanced assemblage of organisms.

Question 4.
Differentiate between ectoparasite an endoparasite.
Answer:

Ecto parasite	Endo parasite
Those organisms which live on the surface of the other living organism and derive food from it eg: lice on human	Those organisms which live inside the body of other living organisms and derive food from it eg: Plasmodium and liver fluke in man.

Question 5.
What is brood parasitism? Give an example of what adaptation has evolved in this phenomenon
Answer:
Brood parasitism is a phenomenon in which one species (parasite) lays eggs in the nest of other species (host) of bird and lets the host incubate them, eg: Cuckoo lays eggs in crow’s nest Cuckoo’s eggs shows resemblance with the eggs of crow in colour size etc which failed to identify by the crow with their eggs.

Question 6.
Name and explain the kind of interaction in the following
(1) Algae and fungi in lichens
(2) Head louse and humans
(3) Hermit crab and sea anemone.
Answer:
(1) Algae and fungi in lichens:-

• This is an example of mutualism in which both are benefited
• Fungi provide protection and help in absorbing water and minerals whereas the algae prepare food for the fungus.

(2) Head louse and human: This is an example of ectoparasitism the parasite gets shelter as well as food from the human’s head.

(3) Hermit crab and sea anemone:- This is an example of commensalism in which sea anemone gets a benefit for moving to places rich in nutrients while the hermit crab neither benefitted nor harmed.

Question 7.

The above graph shows the organisms response to abiotic environmental factors. Name the categories of animals. Which show the pattern a, b, and c respectively and define each of them.
Answer:
(a) Conformers:
These are organisms which cannot maintain a constant internal environment but change the body temperature and osmolarity of their body fluids according to the external conditions.

(b) Regulators:
These organisms which maintain a relatively constant environment called homeostasis.

(c) Partial regulators:
These are organisms which have evolved the capacity to regulate the internal environment of the body to a limited range of external factors beyond which they become conformers.

Question 8.
Explain the following
(i) Predators are conducts of energy transfer
(ii) Predators are prudent in nature
Answer:
(i)

• A predator in a food chain feeds on the prey and obtains energy
• When the predator becomes a prey to another animal in the food chain, it transfers the energy obtained from ‘its’ prey.

(ii) If a predator is too efficient and overexploits the prey, the prey population becomes extinct. As a result predator will also become extinct due to the lack of food and hence predator are said to be prudent in nature.

Question 9.
The Mediterranean orched Ophrys employs a method called sexual deceit to get the flowers pollinated. Explain the phenomenon.
Answer:
In the flower of Ophrys, one petal resembles the female of a bee species in size, colour markings etc.

• The male bee perceives it as a female and pseudo copulates with it.
• During the process the pollengrains from the anthers become dusted on the body of bees. When this bee is attracted to another flower of this orchid species, the process is repeated and the pollen grains falls on the stigma hence pollination is achieved.

Question 10.
Mention any 4 adaptations seen is Xerophytic plants to cope up with water scarcity.
Answer:

• Xerophytes (Desert plants) have thick cuticle on their leaf surface.
• Leaves are absent or reduced to spines to prevent transpiration.
• Presence of sunken stomata to reduce water loss.
• The photosynthetic function is taken up by green flattened stems.

You can Download Chapter 15 Biodiversity and Conservation Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 15 Biodiversity and Conservation

2nd PUC Biology Biodiversity and Conservation NCERT Text Book Questions and Answers

Question 1.
Name the three important components of biodiversity.
Answer:
Genetic diversity, species diversity, and ecological diversity.

Question 2.
How do ecologists estimate the total number of species present in the world?
Answer:
Ecologists make a significant comparison of species richness of exhaustively studied groups of insects of the temperate and tropical regions and extrapolate this ratio to other groups of animals and plants to calculate a gross estimate of the total number of species existing on the earth.

Question 3.
Give three hypotheses for explaining why tropics show the greatest levels of species richness.
Answer:
a. Tropical regions have remained relatively undisturbed for millions of years and thus had a long time for species diversification.
b. Tropical environments are less seasonal, relatively more constant, and predictable.
c. Availability of more solar energy and contributes much productivity.

Question 4.
What is the significance of the slope of regression in a species-area relationship?
Answer:
When analysis of species-area relationships is done among small areas, the values of the slope of regression are remarkably similar regardless of the taxonomic group or the region. However, when such analysis is done among very large areas, i.e., continents, then the slope of regression would be much steeper. Biodiversity also changes with the change in altitude. It increases from higher to lower altitudes.

Question 5.
What are the major causes of species losses in a geographical region?
Answer:
Causes of biodiversity losses:
The extinction of species and consequent loss of biodiversity is due to mainly four major reasons. The Evil Quartet is the sobriquet used to describe them.

Question 6.
How is biodiversity important for ecosystem functioning?
Answer:
Biodiversity is useful in ecosystem services. Maintenance and sustainable utilisation of useful products and services of various ecosystems as well as individual species require the presence of biodiversity. The rich biodiversity is important for stability, productivity, resilience and ecosystem health. Increased biodiversity contributes to higher productivity. Forest and oceanic systems control climate and maintain gaseous composition of the atmosphere through photosynthesis. Biodiversity is essential for natural pest control, maintenance of populations of various species, pollination by insects and birds, nutrient cycling, conservation and purification of water, formation and protection of soil, etc.

Question 7.
What are sacred groves? What is their role in conservation?
Answer:
Sacred groves are forest patches protected by several tribal communities and religious groups due to the religious sanctity of the forest. Such sacred groves are found in Khasi and Jaintia hills in Meghalaya, Aravalli hills of Rajasthan, Western Ghat regions of Karnataka and Maharashtra. In Meghalaya, the sacred groves are the last refuge for a large number of rare and threatened plants.

Question 8.
Among the ecosystem services are control of floods and soil erosion. How is this achieved by the biotic components of the ecosystem?
Answer:
Biotic components of the ecosystem include plants and animals. Floods and soil erosion are prevented by the producers especially trees present in the ecosystem. The roots of trees bind to the soil firmly thus preventing soil erosion by wind or water. Raindrops in a forest do not hit the floor directly. The canopy layer of the forest intercepts the flow of raindrops so that the rainwater falls on the leaves of trees and then drips slowly onto the forest floor. Thus, water does not collect and stagnate on the forest floor. This prevents flooding. Moreover, trees in the forest also regulate the water cycle.

Question 9.
The species diversity of plants (22%) is much less than that of animals (72%). Give explanation.
Answer:
The great structural and resource heterogeneity provided by plants is the principal reason of high animal diversity. A single plant species can accommodate many animal species.

Question 10.
Can you think of a situation where we deliberately want to make a species extinct? How would you justify it?
Answer:
Certain species are the causal organisms of a number of human diseases which are epidemic. Mostly many disease-causing viruses like Varicella virus, Poliovirus, HIV are harmful to human beings and have no role in ecosystem stability as decomposers. But to eradicate the diseases caused by them, these viruses should be eradicated i.e., made extinct if possible.

2nd PUC Biology Biodiversity and Conservation Additional Questions and Answers

2nd PUC Biology Biodiversity and Conservation One Mark Question

Question 1.
What are endemic species?
Answer:
Those species which are confined to a particular region and are not found anywhere in the world are called endemic species.

Question 2.
Where does the Tiger project is established in Madhya Pradesh?
Answer:
Kanha national park.

Question 3.
Name some biodiversity hotspots in India
Answer:
Western Ghats, Himalayas, Indo-Burma region – Srilanka.

Question 4.
Where do great Indian bustards are found in India?
Answer:
Rajasthan, Punjab, Gujrat.

Question 5.
Some plants are used to extract chemicals used as drugs.
a. Mention the type of products extracted.
b. Give some examples of this product and its uses.
Answer:
a. Botano chemicals.
b. Papaver somniferum – Morphine
Chinchona ledgeriana – Quinine
Taxus brevifolia – Taxol

Question 6.
Which part of the world is known as lesser biodiversity?
Answer:
Poles have lesser biodiversity.

Question 7.
Name the district in Kerala
a. which has the highest forest coverage?
b. which has the lowest forest coverage?
Answer:
a. Idukki
b. Alappuzha (has no forest)

Question 8.
Name the unlabeled areas ‘a’ and ‘b’ of the pie chart representing the global diversity of invertebrates showing their proportionate number of species of major taxa (Delhi 2009)

Answer:
(a) Insects
(b) Molluscs

Question 9.
Name the unlabeled areas ‘a’ and ‘b’ of the pie chart representing the biodiversity of plants showing their proportionate number of species of major taxa. (AI2009)

Answer:
(a) Fungi
(b) Angiosperms.

Question 10.
Name the unlabeled areas ‘a’ and ‘b’ of the pie chart representing the biodiversity of vertebrates showing the proportionate number of species of major taxa. (CBSE 2009)

Answer:
(a) Fishes
(b) Amphibians.

Question 11.
Name 2 animals that have become extinct by overexploitation by humans.
Answer:
Steller’s sea cow and the passenger pigeon.

2nd PUC Biology Biodiversity and Conservation Two Marks Questions

Question 1.
Write the scientific name of the plant that yields reserpine. How is genetic variation expressed in this plant?
Answer:

• Rauwolfia vomitoria are the plant that yields reserpine.
• The genetic variation is shown in terms of the potency and concentration of the active chemical reserpine.

Question 2.
What is social forestry?
Answer:
The planning of social forestry started in India in 1976, which is related to the conservation of forests. This project is useful for local people in various ways, such as fulfills their requirements, provides work to the unemployed, uses wasteland, and help to maintain O₂ and CO₂ balance in the atmosphere, etc. Thus, the project is started by the Indian government, the chief objectives of this project are as follows:

• Plantation of useful plants in the forest.
• Development of forests on personal lands by the cooperation of government.
• To prevent the harmful effects of pollution by the development of artificial forests.
• Preservation of endangered wild animals.

Question 3.
Explain co-extinction.
Answer:
It is a phenomenon in which when a species becomes extinct, the plant and animal species associated with an obligatory manner also become extinct. eg:- When a host fish becomes extinct, its unique assemblage of parasites also faces extinction.

Question 4.
Differentiate between zoological and national parks
Answer:

Zoological park	National park
These are the areas where the threatened animals are kept under conditions very similar to their natural habitat.	These are large areas where animals and plants are protected in their natural habitat.
It is an exsitu method os conser­vation.	It is an in situ conservation method.

Question 5.
What are biosphere reserves? How many of them are present in India?
Answer:
Biosphere reserves are the ecologically unique and bio-diversity-rich regions that are legally protected. There are 14 biosphere reserves in India.

Question 6.
Why does the introduction of alien species into an ecosystem cause loss of biodiversity?
Answer:
The alien species become invasive and resources, so there is a decline in the indigenous species.

Question 7.
Name the region of the earth called the “lungs of the planet”. Mention giving reasons, the activities which are being carried out in this region now.
Answer:
Amazon forest is called the “lungs of the planet”. Human activities which are being carried out in this region are

• Grazing of beef cattle
• Cultivation of soya bean crop.

Question 8.
When and where the convention on biological diversity (earth summit) was held? While its aim.
Answer:

• The earth summit was held in Rio de Janeiro in 1992.
• The aim was to make the nation take appropriate measures for the conservation of biodiversity and sustainable utilization of its benefits.

Question 9.
What are sacred groves? Where are they found in India?
Answer:
Sacred groves are the tracts of forests that are set aside where all the trees and wildlife are venerated and given complete protection.
In India, sacred groves are found in

• Kashi and Jaintia Hills in Meghalaya
• Aravalli hills of Rajasthan
• Western Ghat regions of Karnataka and Maharashtra.
• Sarguja, Chanda, and Bastar areas of M.R
• Sarpakavu of Kerala.

Question 10.
Write any five features of Indian forests.
Answer:
Indian forests are characterized by :

1. Indian forests are mainly tropical forests.
2. Himalayan forests are characterized by the presence of coniferous trees.
3. In few parts of our country having temperate forests.
4. Our forests contain a large number of useful varieties of plants and animals.
5. Great variations are present in Indian forests.

2nd PUC Biology Biodiversity and Conservation Three Marks Questions

Question 1.
Differentiate between In situ conservation and Ex-situ conservation.
Answer:
In situ conservation:- It is the method of protecting the endangered species of plants or animals in the natural habitat either by protecting or cleaning up the habitat itself or by defending the species from predators.

• It helps in recovering populations in the surroundings where they have developed their distinct features.

Ex-situ conservation:-

• It is the method of protecting the endangered species of plants or animals by removing them from the unsafe or threatened habitat and placing them under the care of humans.
• It helps in recovering or preventing their extinction under stimulated conditions.

Question 2.
What are the characteristics of a stable community?
Answer:

• A stable community does not show much variation in productivity from year to year.
• Such a community must be either resistant or resilient to occasional disturbances both natural and man-made.
• It must be resistant to invasions by alien species.

Question 3.
Differentiate between Genetic diversity and species diversity.
Answer:

Genetic diversity	Species diversity
(a)  It is a trait of the organisms. (b)  It represents the variety of genetic information present in the organisms. (c)  It is important for adaptation to the enviro­nment and changes occurring in it.	(a) It is a trait of the biotic community. (b) It is a variety of species and their abundance found within a region. (c) It influences the stability of the ecosystem.

2nd PUC Biology Biodiversity and Conservation Five Marks Question

Question 1.
What is the influence of biodiversity on the ecosystem? Mention the 3 possible consequences that loss of biodiversity in a region can lead to.
Answer:
Influences of biodiversity

• The ecosystems with more species diversity show less year-to-year variation in total biomass production.
• The ecosystem with species diversity shows more productivity compared to those with less species diversity.

Consequences are
The loss of biodiversity can lead to

• A decline in the crop productivity
• Increased variability in a certain ecosystem
• A decreased resistance to environmental perturbates like drought.

Question 2.
Prepare a notice to be distributed to the lower classes on the importance of the ‘Conservation of Biodiversity’.
Answer:
The great biodiversity on earth is vital for the existence of mankind.
The reasons for conserving biodiversity are the following.

i. Narrowly utilitarian: This argument for conserving biodiversity are obvious i.e., humans derive countless economic benefits such as food, firewood, fiber, construction materials, industrial products (such as tannins, dyes, lubricant, resins, perfumes etc.), medicinal products etc. More than 25% of medicines are derived from plants and nearly 25,000 species of plants contribute to the traditional medicines used by the native peoples around the world. It is unknown that how many medicinal plants are waiting to be explored in the tropical rain forest.

ii. Broadly utilitarian: This argument says that biodiversity plays a vital role in all ecosystem services. Amazon rain forest alone produces 20% of the total oxygen in the atmosphere through photosynthesis. Can you estimate the economic value of this life-saving gas provided by nature? The other indirect benefits that we receive are
a. Pollination: Without pollination, the plants cannot give us fruits and seeds. The pollination is done by bees, birds, bats etc.

b. Aesthetic and cultural benefits: The aesthetic values include ecotourism, bird watching, wildlife, pet-keeping, gardening, etc. Plants like Tulsi (Ocimum sanctum), Pipal (Ficus religiosa) etc. are considered sacred and are used by many Indians for religious purposes. Nowadays we recognize plants and animals as symbols of national pride and cultural heritage. Walking through a forest, watching spring flowers in full bloom or waking up to a bulbul’s song in the morning etc. also gives pleasure and smoothness.

iii. Ethical argument: This says that we have a moral responsibility to take care of earth’s biodiversity such as millions of plants, animals, microbes etc. with whom we share this planet. We need to realize philosophically or spiritually that each and every species on the earth has its own intrinsic value.

Question 3.
“Ecology is permanent economy”. This is the Chipko slogan coined by Sundarlal Bahuguna. Write a short note on Chipko Movement.
Answer:
It is one of the People’s movements in biodiversity conservation. The Chipko Movement is the result of hundreds of decentralized and locally autonomous initiatives. Its leaders and activists are primarily village women, acting to save their means of subsistence and their communities. Men are involved too, however, and some of these have given wider leadership to the movement. Prominent Chipko figures include: Sunderlal Bahuguna, a Gandhian activist and philosopher, whose appeal to Mrs. Gandhi resulted in the green-felling ban and whose 5,000-kilometer trans-Himalaya foot march in 1981-83 was crucial in spreading the Chipko message. Bahuguna coined the Chipko slogan: ‘ecology is the permanent economy’.

Question 4.
Describe the National and International efforts prescribed for the conservation of forests.
Answer:
Forest conservation is started in India on a national level by the British government. In 1856, Lord Dalhousie had formulated a policy for the conservation of forest in Burma. In 1894, the Indian government also prepared a forest policy on a national level. The main points of this policy are:

• Forest management,
• Proper use of forest land,
• Policy for protected forests,
• Improved forest production.

The Indian government established national parks, sanctuaries, and zoological parks. The F.A.O. of the United Nations is also functioning on forest conservation on an international level. This organization also provides financial help for this purpose. In 1952, the Indian government also prepared India’s New National Forest Policy under the direction of F.A.O. Forest policy has been planned for

• Prevention of deforestation of hill plants.
• Reforestation of grazing land.
• Development of grazing land,
• Plantation of economically useful forest trees.
• Increase in the profit of government from forests.

Question 5.
Which are the different “methods of in situ conservation?
Answer:
In situ conservation is the process of protecting the whole ecosystem and its biodiversity at all levels. The endangered species of plants and animals are protected in their natural habitat without disturbing them from their own habitat. It helps in recovering the population in the surroundings where they have developed their distinctive features.

• Hotspots -These are the regions with high levels of species richness and a high degree of endemism to provide maximum protection.
• Biosphere reserves – These are ecologically unique and biodiversity-rich regions that are legally protected. In India, there are 14 biosphere reserves.
• National park and wildlife sanctuaries- These are the places where animals are in their own undisturbed habitat but protected these areas by law.
• In India, there are 90 national parks and 448 wildlife sanctuaries are there.
• Sacred groves – These are some patches of forest where all the trees and wildlife within are venerated and given total protection, eg: Sarpakavu in Kerala. Sarguja area of M.P. etc.

You can Download Chapter 12 Biotechnology and its Applications Questions and Answers, 1st PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 12 Biotechnology and its Applications

2nd PUC Biology Biotechnology and its Applications Ncert Text Book Questions and Answers

Question 1.
Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because
(a) bacteria are resistant to the toxin
(b) toxin is immature;
(c) toxin is inactive;
(d) bacteria encloses toxin in a special sac.
Answer:
(c) Bacillus thuringiensis forms protein crystals during a particular phase of their growth. These crystals contain a toxic insecticidal protein. Actually, the Bt toxin protein exists as inactive protoxins but once an insect ingests the inactive toxin, it is converted into an active form of toxin due to the alkaline pH of the insect gut which solubilise the crystals. The activated toxin binds to the surface of midgut epithelial cells and creates pores that cause cell swelling and lysis and eventually cause the death of the insect, but it does not harm Bacillus itself.

Question 2.
What are transgenic bacteria? Illustrate using any one example. (CBSE – 2006)
Answer:
Bacteria carrying foreign genes are called transgenic bacteria. For example, two DNA sequences (A and B chains of human insulin) were introduced into the plasmid of bacteria E.coli. The leans genic bacteria start producing insulin chains.

Question 3.
Compare and contrast the advantages and disadvantages of the production of genetically modified crops.
Answer:
Advantages of GM crops:

• Genetic modification has made crops more tolerant to abiotic stresses (cold, drought, heat, salt.)
• Viral resistance can be introduced.
• Over ripening, losses can be reduced. Example: Flavr Savr Tomato.
• Enhanced nutritional value of food. Example: Golden Rice.
• Reduced reliance on chemical pesticides.

Disadvantages of GM crops:

• Transgenes in crop plants can endanger native species.
• Example: The gene for Bt toxin expressed in pollen may end natural pollinators such as honeybees.
• Weeds also become resistant.
• Products of transgenes may be allergic or toxic.
• They cause damage to the natural environment.

Question 4.
What are Cry proteins? Name an organism that produces it. How has man exploited this protein to his benefit?
Answer:
Cry proteins are protein responsible for killing lepidopteran insect and their larvae (also called Bt toxin). It is secreted by Bacillus thuringienesis. Man exploited gene encoding this toxin, by transferring it into cotton genome with the help of Agrobacterium TDN A as vector.

Question 5.
What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency,
Answer:
It is a collection of methods which allows correction of a gene defect that has been diagnosed in a child or embryo. In gene therapy, normal genes are inserted into a person’s cells or tissues to treat a hereditary defect. Gene therapy is being tried for sickle cell anaemia and Severe Combined Immuno Deficiency (SCID).

In some children, ADA deficiency can be cured by bone marrow transplantation. In others, it can be treated by enzyme replacement therapy, in which functional ADA is given to the patient by injection. However, both of these approaches are not completely curative.

In gene therapy, lymphocytes from the blood of the patient are grown in a culture outside the body. A functional ADA cDNA (using a retroviral vector) is then introduced into these lymphocytes, which are subsequently returned to the patient. Because these cells are not immortal, the patient requires a periodic infusion of such genetically engineered lymphocytes. However, if the gene isolated from marrow cells producing ADA is introduced into cells at early embryonic stages, the disease could be cured permanently.

Question 6.
Diagrammatically represent the experimental steps in cloning and expressing a human gene (say the gene for growth hormone) into a bacterium like E. coli?
Answer:
The given diagram represents the experimental steps in cloning and expressing a human gene for growth hormone into a bacterium E. coli.

Question 7.
Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of rDNA technology and the chemistry of oil?
Answer:
To remove oil from seeds using recombinant DNA technology would involve:

• Identifying the genes that code for oil production.
• Deleting these genes from the seed genome.
• Splicing back together with the remaining DNA.
• Putting it back into the cell.

It will not be very easy because the oils are made up of fatty acids and glycerol. Since fatty acids are important components of the cell membrane system, deleting or switching off of its genes might affect the cell structure itself.

Question 8.
Find out from the internet what is golden rice.
Answer:
Golden rice is transgenic rice having gene coding for vitamin A synthesis enzyme. Golden rice was developed by the Swiss Federal Institute of Technology, rich in vitamin A (beta carotene). The rice grains are golden yellow in colour due to colour it gets from the beta carotene.

Question 9.
Does our blood have proteases and nucleases?
Answer:
No, our blood does not contain enzyme proteases and nucleases. If these two enzymes were there in the blood, it causes the degeneration of blood cells and lining cells of blood cells.

Question 10.
Consult the internet and find out how to make orally active protein pharmaceuticals. What is the major problem to be encountered?
Answer:
Proteinaceous drugs cannot be taken orally because they can be degraded by the proteases of our alimentary canal. To counteract this problem or to make an orally active protein pharmaceutical, it must be coated by a film that is resistant to protein degrading enzymes.

2nd PUC Biology Biotechnology and its Applications Additional Questions and Answers

2nd PUC Biology Biotechnology and its Applications One Mark Questions

Question 1.
Name the organism whose genetic material has been altered using genetic engineering techniques.
Answer:
Genetically Modified Organisms (GMO).

Question 2.
Genetically modified cotton is named Bt cotton. What does the prefix ‘Bt’ mean?
Answer:
Cotton containing a toxin gene from Bacillus thuringiensis

Question 3.
Through whom Bt toxin protein originates?
Answer:
By Bacillus thuringiensis.

Question 4.
Biopiracy affects developing countries like India more than industrialized nations because our country is rich in ………………. and …………………. related to bio-resources.
(Bioetics / Biodiversity/Biopatent, Traditional resources/Traditional cultivation/Traditional knowledge)
Answer:
Biodiversity and Traditional knowledge

Question 5.
Full form of RNAi.
Answer:
RNA interference (RNAi).

Question 6.
What GEAC?
Answer:
Genetic engineering Approval committee.

Question 7.
Name the scientific name of bacteria in which be form organism toxin.
Answer:
Bacillus thuringiensis.

Question 8.
A multinational company outside India tried to sell new varieties of turmeric without proper patent rights. What is such an act referred to as?
Answer:
Biopiracy

Question 9.
What is Hirudin?
Answer:
It is a protein which prevent blood dotting.

2nd PUC Biology Biotechnology and its Applications Two Marks Questions

Question 1.
In case of Bt Cotton how does the toxic insecticide protein produced by the bacterium kill the insect pest but not the cells of Bacillus thuringiensis where the toxic protein is generated?
Answer:
The toxin produced by Bacillus thuringiensis is an endotoxin called cry protein. It is crystalline and nontoxic when formed being in the protoxin stage. As it reaches the gut of insects, the cry protein is converted into toxic and soluble state. It attaches the receptors present on the epithelial cells of the gut produces pores and kills the cells resulting in the death of the insects.

Question 2.
What are the 4 main objectives of genetically modified crop plants? (CBSE 2008)
Answer:

• Higher nutritional value eg: Vitamin. A in golden rice
• Abiotic stresses- Increased tolerance to drought etc.
• Post Harvest losses- Prevention of over-ripening and other post-harvest losses.
• Insect and Pest resistance. eg: Bt-cotton.

Question 3.
Define transgenic organisms (CBSE 2006)
Answer:
They are organisms which have been modified genetically through the introduction of genes of another organism artificially by the technique of genetic engineering instead of conventional hybridisation.

Question 4.
How is early detection of diseases possible using molecular diagnostics?
Answer:

• Low concentration of viral or bacterial DNA in the host cell/body can be detected much before the symptoms of the disease appear i.e. early detection of disease is possible
• Clones of genes can be used to as probe to detect the presence of mutual alleles in cancer suspected patients.

Question 5.
Name any two biological products that are produced in transgenic animals and mention their uses.
Answer:

• a-1- antitrypsin is used to treat emphysema.
• a-lactalbumin is produced in the milk of the transgenic cow, Rosie, this is a nutritionally more balanced product for human babies than normal cow milk.

Question 6.
Bacillus thuringiensis makes our environment pesticide-free. Comment.
Answer:
Bacillus thuringiensis produces a toxin called Bt toxin. Gene for Bt toxin has been cloned from bacteria and been expressed in plants to provide resistance to pests. In this manner, many plants are produced. So in the future, this makes our environment pesticide-free.

Question 7.
What is the cause of adenosine deaminase deficiency in a person?
Answer:
It is due to the deletion of the gene coding for the enzyme adenosine deaminase, this enzyme is crucial for the functioning of the immune system.

Question 8.
Briefly describe the RNA interference process for preventing nematode infestation of plants.
Answer:
RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defense. This method involves the silencing of a specific mRNA due to a complementary double-stranded RNA molecule that binds to it and prevents translation of mRNA. The source of this complementary RNA could be from injection by viruses having RNA genomes or mobile genetic elements.

Question 9.
Why does Bt toxin not kill the bacillus? How does it kill the insect larvae?
Answer:

• When Bt toxin is ingested by an insect, it is converted into its active form when exposed to the alkaline pH in the gut.
• The activated toxin binds to the surface of the epithelial cells of the midgut creates pores.
• Water enters the cells and causes their swelling and lysis.

Question 10.
Write the advantages of recombinant therapeutics?
Answer:
The recombinant therapeutics do not induce any unwanted immunological response like the similar products of non-human origin such therapeutics are highly effective.

Question 11.
How is ELISA used to detect pathogens in the body?
Answer:

• Pathogens are detected by the presence of antigens, which may be a protein or glycoprotein.
• Pathogens can be also be detected by the presence of antibodies synthesized against the pathogens.

2nd PUC Biology Biotechnology and its Applications Three Marks Questions

Question 1.
What is genetically modified (GM) food? Give two examples.
Answer:
Genetically modified food (GM food): The food substances produced from genetically modified crops or transgenic crops is called GM food. This food differs from conventionally developed varieties in the following aspects :

• GM food contains an antibiotic resistance gene itself.
• It contains protein produced by transgene, e.g. Cry protein in insect resistance varieties.
• These GM foods contain enzyme produced by the antibiotic resistance gene that was used during gene transfer by recombinant DNA technology.

Examples of GM Crops, Food, and Fruits:

1. Flavr Savr Tomato: It is the first food containing genetically engineered DNA. . These tomatoes contain genes for antibiotic resistance for kanamycin.

2. Maize: GM maize has a bacterial gene that increases its resistance to pests and
diseases. It also has a gene for ampicillin resistance which is harmful for us, therefore the introduction of GM maize is opposed by many European countries. ,

3. Rape oilseed: It is a new type of plant that contains genes for resistance to the herbicide Basta. It has more potential, dangers and can become a weed and would be impossible to control with Basta. It could cross-fertilize with relatives such as wild mustard, thus, spreading the resistance to wild plants. Such type of environmental risks could occur with genetically modified rapeseed crop. They might also affect food chains in unpredictable ways.

Question 2.
Mention three reasons for the success of the green revolution in India.
Answer:

• Use of improved verities of crops
• Employing better management practice
• Use of agrochemicals such as fertilizers and pesticides.

Question 3.
Enumerate the fields of application of biotechnology.
Answer:
The applications of biotechnology include

• Molecular diagnostics
• Bioremediation
• Waste treatment
• Energy production
• Therapeutics.

Question 4.
Explain the steps involved in the production of genetically engineered insulin.
Answer:
Insulin used for diabetes was earlier extracted from the pancreas of slaughtered cattle and pigs. Insulin consists of two short polypeptide chains, chain A and chain B that are linked together by disulphide bridge.

In mammals, including humans, insulin is synthesised as a prohormone which contains an extra stretch called the C peptide. This C peptide is not present in the mature insulin and is removed during maturation into insulin. The main challenge for the production of insulin using rDNA techniques was getting insulin assembled into a mature form.

In 1993 Eily Lilly an American company prepared two DNA sequences corresponding to A and B, chain of human insulin and introduced them in the plasmid of E.coli to produce insulin chains, Chains A and B were produced separately, extracted, and combined by creating disulphide bonds to form human insulin.

Question 5.
Name any 6 plants where Bt toxin-producing genes have been included.
Answer:

• Cotton
• Tomato
• Rice
• Potato
• Soybean
• Com.

2nd PUC Biology Biotechnology and its Applications Five Marks Questions

Question 1.
Two of the steps involved in producing nematode-resistant tobacco plants base on the process of RNA I are mentioned below. Write the missing steps in the proper sequence.
Answer:

• Nematode specific genes
• Production of both sense and antisense RNAs
• Double strand RNA
• Silencing specific mRNAs of nematode
• Death of nematodes
• Protection of transgenic plants from nematodes.

Question 2.
Describe the application of genetic engineering in the field of Agriculture and Medicine.
Answer:
(A) Application of Genetic engineering or Biotechnology in Agriculture: Genetic engineering is found to be very beneficial in agriculture. Its important use in agriculture are:
1. Increase in photosynthetic efficiency: An increase in photosynthetic efficiency of crop plants can be achieved by introducing suitable Carbon dioxide Fixation Gene (cfx) from any plant into the crop plants.

2. Transfer of nitrogen-fixing ability: Number of symbiotic and non-symbiotic micro-organisms have a capacity of fixing atmospheric nitrogen. Nitrogen fixers are found to possess nitrogen-fixing gene (nif genes) which are located on chromosomes or plasmids. Introduction of nif gene in crop plants results inability in crop plants to fix atmospheric nitrogen and reduction in the use of chemical nitrogen fertilizers.

3. Disease resistance in crop plants: Plant breeders at present are developing high-yield varieties by transferring genes for disease resistance through conventional breeding.

4. Plant tissue in crop improvement: Some of the areas of plant improvement where tissue culture has been applied with success are as follows :

• Rescuing hybrids through embryo culture.
• Multiplication of germplasm.
• Production of disease-free plants.
• Production of haploid through another culture.
• Somaclonal variation.
• Somatic hybridization.
• Cryopreservation of germplasm.

5. VAM (Vesicular-Arbuscular Mycorrhiza) fungi with Rhizobium can boost the yields: Recently there has been a new dimension to this farm practice by the way of increasing Rhizobium inoculation effect by simultaneous inoculating seeds with VAM as well as Rhizobium culture. VAM is a structural modification of hyphae helping in absorption and storage of phosphorus.

(B) Application of Genetic engineering in the Medical field:

1. Hereditary diseases like color-blindness, haemophilia which are caused by recessive genes and also many inborn metabolic disorders due to defective genes as alkaptonuria, phenylketonuria can be cured with gene therapy.
2. Substances like vitamins, hormones, amino acids and antibodies can be synthesized in bacteria by introducing the genes which code these substances. In this way, bacteria can be used as biofactories for the synthesis of these substances.
3. Production of insulin: Insulin is a medicine used for the treatment of diabetes. Initially, it is derived from animals (pig and cows) but today it is produced by gene splicing.
4. Hepatitis-B vaccine: Hepatitis-B is a viral disease of the liver. Today this vaccine is prepared with the help of genetic engineering.

You can Download Chapter 11 Biotechnology: Principles and Processes Questions and Answers, 1st PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 11 Biotechnology: Principles and Processes

2nd PUC Biology Biotechnology: Principles and Processes NCERT Text Book Questions and Answers

Question 1.
Can you list 10 recombinant proteins which are used in medical practice? Find out where they are used as therapeutics (use the internet).
Answer:
Recombinant proteins used in medical practice as therapeutics are as follows:

• OKT-3, a therapeutic antibody is used for the reversal of acute kidney transplantation rejection.
• ReoPro is for the prevention of blood clots.
• Tissue plasminogen activator (TPA) is for acute myocardial infarction.
• Asparaginase is for the treatment of some types of cancer.
• DNase is for the treatment of cystic fibrosis.
• Insulin is used in diabetes mellitus.
• Blood clotting factor VIII is used for the treatment of haemophilia A.
• Blood clotting factor IX is for the treatment of haemophilia B.
• Hepatitis B vaccine is for the prevention of hepatitis B.
• Platelet-derived growth factor has been approved for diabetic/skin ulcers. It also stimulates wound healing.

Question 2.
Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate. DNA on which it acts, the site at which it cuts DNA, and the product it produces.
Answer:

Question 3.
From what you have learned, can you tell whether enzymes are bigger or DNA is bigger in molecular size? How did you know?
Answer:
Human cells vary in size and volume. DNA is fixed in its size. That makes it kind of hard (like impossible) to state a concentration for DNA. Only a range can be given, and that information has little to no practical value and even less meaning.

Question 4.
What would be the molar concentration of human DNA in a human cell? Consult your teacher.
Answer:
Molar concentration is the ratio of the number of moles of solute in a solution divided by the volume of the solution expressed in liters.
The average weight of a DNA basepair = 650 daltons (1 dalton equals the mass of a single hydrogen atom or 1.67 x 10^-24 grams)
The molecular weight of a double-stranded
DNA molecule = Total no. of basepairs x 650 daltons
The human genome is 3.3 x 10⁹ bp in length.
Hence, the weight of human genome,
= 3.3 x 10⁹ bp x 650 Da
= 3.59 x 10^-12 gm.
The molar concentration of DNA can be calculated accordingly.

Question 5.
Do eukaryotic cells have restriction endonucleases? Justify your answer.
Answer:
The stirred tank bioreactor facilitates the mixing and oxygen availability. It controls the temperature and pH inside the bioreactor.

Question 6.
Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors to have over shake flasks?
Answer:
Shake flasks are used for growing and mixing the desired materials on a small scale in the laboratory. Bioreactors are vessels in which raw materials are biologically converted into specific products by microbes, plant and animal cells, and their enzymes. Bioreactors are used for large-scale production of biomass or sell products under aseptic conditions. Here large volumes (100-1000 litres) of culture can be processed. A bioreactor provides the optimal conditions for achieving the desired product by providing optimum growth conditions (temperature, pH, substrate, salts, vitamins, oxygen). The most commonly used bioreactors are of stirring type.

A bioreactor is more advantageous than shake flasks. It has an agitator system to mix the contents properly, an oxygen delivery system to make available of oxygen, a foam control system, a temperature control system, a pH control system, and a sampling port to withdraw the small volumes of the culture periodically.

Question 7.
Collect 4 examples of palindromic DNA sequences by consulting your teacher. Better try to create a palindromic sequence by following base-pair rules.
Answer:

Question 8.
Can you recall meiosis and indicate at what stage recombinant DNA is made?
Answer:
Meiosis I – Pachytene – When recombination nodule appears after synaptonemal complex formation.

Question 9.
Can you think and answer how a reporter enzyme can be used to monitor the transformation of host cells by foreign DNA in addition to a selectable marker? Ans: A selectable marker helps to identify transformed host cells and non transformed cells will be eliminated and only transformed cells will grow. Whereas reporter gene is the one whose phenotypic expression can be monitored and thus it reports about activity or change in advance of the effect of the modification, in addition to eliminating non transformed cells by selectable markers. HLDescribe briefly the followings:
(a) Origin of replication
(b) Bioreactors
(c) Downstream processing
Answer:
(a) Origin of replication (on): One of the major components of a plasmid is a sequence of bases where replication starts. It is called the origin of replication (on). This is a specific portion of the plasmid genome that serves as a start signal for self-replication (to make another copy of itself). Any piece of DNA when linked to this sequence can be made to replicate within the host cells. This property is used to make a number of copies of linked DNA (or DNA insert).

(b) Bioreactors: These are vessels in which raw materials are biologically converted into specific products by microbes, plant and animal cells, and their enzymes. They are allowed to synthesise the desired proteins which are finally extracted and purified from cultures. Small volume cultures are usually employed in laboratories for research and production of fewer quantities of products. However, large-scale production of the products is carried out in bioreactors’. The most commonly used bioreactors is a stirring type bioreactor (fermenter) that has a provision for batch culture or continuous culture.

(c) Downstream processing: After the formation of the product in the bioreactors, it undergoes some processes before a finished product is ready for marketing. These processes include separation and purification of products which are collectively called downstream processing. The product is then subjected to quality control testing and kept in suitable preservatives. The downstream process and quality control test are different for different products

Question 11.
Explain briefly
(a) PCR
(b) Restriction enzymes and DNA
(c) Chitinase
Answer:
a. The in vitro amplification of DNA by repeated cycles of strand separation and polymerisation is PCR.
b. The nuclease enzyme that cuts the DNA at a unique sequence is called restriction endonuclease. They are also known as molecular knives, molecular scissors, or molecular scalpels.
c. Chitinase is digestive enzymes that break down glycosidic bones in chi tin.

Question 12.
Discuss with your teacher and find out how to distinguish between
(a) Plasmid DNA and Chromosomal DNA
(b) RNA and DNA
(c) Exonuclease and Endonuclease
Answer:

(a) Plasmid DNA and Chromosomal DNA

Plasmid DNA	Chromosomal DNA
(i) It is extranuclear DNA	It is nuclear DNA
(ii) It caries nonvital genes	It possesses vital genes
(iii) A bacterial cell may carry one to several plasmid DNAs.	A bacterial cell carries only one chromosome DNA

(b) RNA and DNA

RNA	DNA
(i) It is ribonucleic acid	Deqxy ribonucleic acid
(ii) It is single strandred	Double standard
(iii) RNA produced from DNA template	Parental DNA acts as a DNA template
(iv) Nitrogen base Uracil is present instead of thymine, which pairs with adenine.	Thymine pairs with adenine

(c) Exonuclease and Endonuclease

Exonuclease	Endonuclease
(i) It breaks DNA from ends	It cuts DNA from inside
(ii) The separated fragments are small nucleotides	These separated fragments  are generally large sized
(iii) The separated fragments cannot be used in genetic engineering	The desirable separated fragments are used in genetic engineering

2nd PUC Biology Biotechnology: Principles and Processes Additional Questions and Answers

2nd PUC Biology Biotechnology: Principles and Processes One Mark Question

Question 1.
By observing the given pair fill-up the blanks

1. Cutting DNA : Restriction endonuclease :: Joining DNA : …………………….
2. Chitinase : Fungus :: Cellulose : ………………………..
3. Protein : Protease :: RNA : …………………………

Answer:

1. DNA ligase
2. Plant cells
3. Ribonuclease

Question. 2.
Which DNA polymerase is active in high temperatures?
Answer:
Taq DNA polymerase is active at high temperatures.

Question 3.
Restriction endonucleases are used to cut DNA at specific sites.. Name the first endonuclease isolated from Escherichia coli.
Answer:
EcoRI

Question. 4.
Write the full form of PCR. Which enzyme is used in?
Answer:
Polymerase Chain Reaction (PCR).
Taq DNA is used in PCR.

Question 5.
Name the technique used for separating DNA fragments in the laboratory
Answer:
Electrophoresis. (Dehli 2005)

Question. 6.
First recombinant DNA was formed in.
Answer:
In Bacteria Salmonella Typhimurium.

Question 7.
Write the function of the restriction enzyme in a bacterial cell?
Answer:
Responsible for restricting the growth of bacteriophage.

Question. 8.
Where does Hind II cut the DNA molecule?
Answer:
It cuts the DNA molecule at a specific 6 base pair seQuestionuence.

Question 9.
Why are plasmids and bacteriophages commonly used as cloning vectors?
Answer:
Plasmids and bacteriophages have the ability to replicate within bacterial cells independently of the chromosomal DNA.

Question. 10.
Which type of charge found in DNA?
Answer:
Negative charge.

Question 11.
What is downstream processing?
Answer:
Downstream processing is the recovery of product from the fully grown genetically modified cells, its purification and preservation

Question. 12.
What is electrophoresis?
Answer:
Electrophoresis is a techniQuestionue used in laboratories in order to separate macromolecules based on size.

Question 13.
What is gene therapy?
Answer:
It is the replacement of a defective gene by normal healthy and functional gene. This method helps to overcome the effect of various disorders like sickle cell anaemia, alkaptonuria, SCID, colour blindness etc.

Question. 14.
Name the technique in which we should be isolated the DNA segment.
Answer:
Electrophoresis.

Question 15.
What is amplification?
Answer:
It is the process of making multiple copies of gene/DNA segments of interest.

Question 16.
What is recombinant protein?
Answer:
It is a biochemical compound or useful protein produced inside the heterologous host cell by recombinant biotechnology method.

Question 17.
What is a bioreactor or fermenter?
Answer:
It is a container in which the biochemical process is carried out by using living cells and their growth medium.

Question 18.
What meant by bioconversion?
Answer:
It is the process by which raw materials are biologically converted into specific products using microbes, plant or animal cells and or their enzymes.

Question 19.
Why are antibiotic resistance genes used as selectable markers for E.Coli?
Answer:
Since E.Coli doesn’t have any of antibiotic resistance genes, antibiotic resistance genes are used from outside as selectable marker.

2nd PUC Biology Biotechnology: Principles and Processes Two Marks Questions

Question 1.
Name the scientists who constructed recombinant DNA. Name the bacterium from which they isolated the gene.
Answer:
Stanley Cohen and Herbert Boyer were the first to construct recombinant DNA. They isolated the gene from the bacterium. Salmonella typhimurium.

Question 2.
Few gaps have been left in the following table showing certain terms and their meanings, fill up the gaps.
Term Meanings
(i) ………….. Non-coding sequence in eukaryotic DNA
(ii) ………….. The technique used in solving paternity disputes
(iii) Restriction endonuclease …………..
(iv) Plasmids …………..
(v) Transgenics …………..
(vi) Nucleotide sequences with single base deficiencies …………….

Question 3.
Name the particular technique in biotechnology whose steps are shown in the figure use the figure to summarize the technique in three steps.
Answer:

• Template stand
• DNA fingerprinting
• Extranuclear DNAs
• Organisms having genes of other organisms obtained through genetic engineering.
• Single nucleotide polymorphism. (SNPs)

Question 3.
Name the particular technique in biotechnology whose steps are shown in the figure use the figure to summarize the technique in three steps.
Answer:

(a) Recombinant technology
(b)

• Cutting and isolation of human gene
• Incorporation of human gene into the plasmid to produce recombinant DNA or plasmid
• Incorporation of recombinant plasmids into bacterium to obtain gene product

Question 4.
Refer to the diagram and answer the following:
(i) From what T₁– plasmid is obtained?
(ii) Name the enzyme which is involved in step I
(iii) What happens in step II
(iv) The plant produced is called hybrid or transgenic
(v) Will the plant produced have other genes along with desired genes? Yes or No explain.
Answer:

(i) Agrobacterium tumefaciens
(ii) Restriction endonuclease
(iii) Incorporation of genes in T₁ plasmid in the region of T-DNA.
(iv) Transgenic
(v) Yes. Selectable marker gene which is often an antibiotic resistance gene

Question 5.

Study the linking of DNA fragments shown above
(i) Name “a” DNA and “b” DNA
(ii) Name the restriction enzymes that recognize this palindrome
(iii) Name the enzyme that can link these two DNA fragments (CBSE 2008)
Answer:
(i) (a) – vector DNA
(b) – foreign DNA

(ii) EcoRI
(iii) DNA ligase

Question 6.
Explain the importance of
(a) Ori
(b) amp R and
(c) rop in E. Coli vector shown below (CBSE 2008)
Answer:

• Ori – Origin of replication
• amp R – ampicillin antibiotic resistance gene
• rop – gene that produces proteins involved in the replication of plasmid.

Question 7.
An interesting property of restriction enzymes is molecular cutting and pasting Restriction enzymes typically recognize a symmetrical

Notice that the top strand is the same as the bottom strand but reads backward. When the enzyme cut the strand between G and A, it leaves overhanging chains

(A) What is the symmetrical sequence of DNA known as?
(B) What is the significance of these overhanging chains?
(C) Name the restriction enzyme that cuts the strand between G and A.
Answer:
(A) Palindromic sequence
(B) sticky ends
(C) Eco RI

Question. 8.
What is DNA ligase?
Answer:
DNA ligase is a specific type of enzyme, a ligase that facilitates the joining of DNA strands together by catalyzing the formation of a phosphodiester bond.

Question 9.
What are cloning vectors? What functions do these vectors perform?
Answer:
Cloning vectors are those organisms on their DNAs which can multiply independently of the host DNA and increase their copy number along with the alien DNA attached to them. Functions are:

• They help in linking the foreign/alien DNA with that of the host
• They also help in the selection of recombinants from non-recombinants

Question. 10.
What is Ti-plasmid?
Answer:
Ti or tumor-inducing plasmid is a plasmid that is a part of the genetic equipment that Agrobacterium tumefacient use to transduce their genetic material to plants.

Question 11.
Palindromic nucleotide sequences have significance in recombinant DNA technology. Explain. Give example for a palindromic DNA sequence.
Answer:
Palindrome in a DNA is a sequence of base pairs that reads same on the two strands when orientation of reading is kept the same. Each restriction endonuclease recognises a specific palindromic nucleotide sequence and cuts the strand of DNA a little away from the centre of the palindrome site, but between the two bases on the opposite strands.
Example of palindrome DNA is
5′ – GAATTC – 3′
3′ – CTTAAG – 5′

Question. 12.
Name the scientist who discovered the artificial DNA synthesizing method.
Answer:
The Nobel prize in physiology in 1968 was awarded jointly to Robert W. Holley, Hargobind Khorana, and M. Nirenberg for their interpretation of the genetic code.

2nd PUC Biology Biotechnology: Principles and Processes Three Marks Question

Question 1.
Given below are the different steps in recombinant DNA technology. Arrange them according to the sequence of occurrence.
a. Transferring the recombinant DNA into the host.
b. Extraction of the product.
c. Fragmentation of DNA by restriction endonucleases
d. Ligation of DNA fragment into a vector.
e. Isolation of DNA.
f. Culturing the host ceils in a medium at large scale.
g. Isolation of the desired DNA fragment.
Answer:
a. Isolation of DNA.
b. Fragmentation of DNA by restriction endonucleases
c. Isolation of the desired DNA fragment.
d. Ligation of DNA fragment into a vector.
e. Transferring the recombinant DNA into the host.
f. Culturing the host cells in a medium at large scale.
g. Extraction of the product.

Question 2.
Represent diagrammatically the E Coli cloning vector pBR 322 showing the restriction site.
Answer:

Question 3.
Draw a labelled diagram of a sparged stirred tank bioreactor.
Answer:

Question 4.
Read the following base sequence of a certain DNA strand and answer the questions that follow.

(i) What is called “Palindromic sequence” in a bNA?
(ii) Write the Palindromic nucleotide sequence shown in the DNA strand given and mention the enzyme that will recognise such a sequence.
(iii) State the significance of enzymes that identify palindromic nucleotide sequences.
(AI – 2008)
Answer:
(i) A palindromic sequence of DNA is a sequence of base pairs that reads the same on the two strands, when orientation of reading is kept the same, i.e. in the 5′ → 3′ direction.
(ii) 5′ GAA TT C – 3′
3′ CTTA AG – 5′
This sequence is restricted by the restriction enzyme Eco RI
(iii) The enzyme that identifies the palindromic nucleotide sequence cuts the strands between the same 2 bases, more often producing sticky ends; hence they are useful in the formation of recombinant DNA.

2nd PUC Biology Biotechnology: Principles and Processes Five Marks Question

Question 1.
Describe in detail the components of a simple stirred tank bioreactor along with a labeled diagram.
Answer:
A stiered tank bioreactor is usually a cylindrical vessel with a curved base to facilitate the mixing of the content. The stirrer facilitates even mixing and oxygen availability throughout the bioreactor.

The bioreactor has an agitator system, an oxygen delivery system along with a foam control system, a temperature control system, pH control system and sampling ports to remove small volumes of culture periodically. It provides optimum growth conditions of pH, temperatures, substrate, oxygen etc. for achieving the desired products.

Question. 2.
What is a clone? Give its preparation, extracted and purified.
Answer:
An organism or cell or group of organisms, produced asexually from an ancestor, to which they are genetical.

1. Gene cloning: Following steps are used by gene cloning:

1. Preparation of gene: DNA extracted from an organism, with the gene of interest is cut into gene size pieces with a restriction enzyme.

2. Insertion into a vector: Bacterial plasmids are cut with the same restriction enzyme. Plasmids are small circles of DNA in bacterial cells that are naturally present in addition to the bacterial other DNA.

3. Transformation of host cells: The recombinant plasmids are then transferred into bacteria using either electrophOration. The plasmid is small enough to pass through the holes into the cells. However, rather than using electricity to create holes in the bacterium, it is done by alternating the temperature between hot and cold. The bacteria are grown on a culture dish and allowed to grow into colonies. All the colonies on all the plates are called a gene library.

2. Plant cloning: Plant tissue culture is a method of propagation that has been sprouting in popularity as an alternative to cloning.

The plant can be cloned artificially using tissue culture. Vegetative propagation works because the end of the cutting forms a mass of nonspecialized cells called a callus, the callus will grow divide and form various specialized cells eventually forming a new plant.

Question 3.
(a) If the restriction enzyme has to cut a DNA, the DNA must be in pure form, i.e. free from the associated RNA and proteins. How is it achieved?
(b) Represent only diagrammatically the steps in the recombinant DNA (r DNA) technology.
Answer:
(a) The RNAs are removed by using enzymes called ribonucleases (RNases) The proteins are removed by using enzyme proteases.
(b)

Question 4.
(a) Show only diagrammatically the three steps in the polymerase chain reaction,
(b) How is repeated amplification achieved using this method?
Answer:

(b) Repeated amplification is achieved by the use of a thermostable DNA polymerase, it is isolated from the bacterium Thermus aquaticus. It remains active during the high temperature used for denaturation of the double-stranded DNA.

Question 5.
Make a diagrammatic representation of showing a restriction enzyme, the substrate DNA on u which it acts the site at which it cuts DNA and the product it produces.
Answer:

You can Download Chapter 6 Molecular Basis of Inheritance Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 6 Molecular Basis of Inheritance

2nd PUC Biology Molecular Basis of Inheritance Ncert Text Book Questions and Answers

Question 1.
Group of the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil, and Cytosine.
Answer:
Nitrogenous bases: Adenine, Thymine, Uracil and Cytosine.
Nucleosides: Cytidine and Guanosine.

Question 2.
If a double-stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Answer:

Question 3.
If the sequence of one strand of DNA is written as follows:
5ATGCATGCATGC ATGCATGCATGC ATGC-3′
Write down the sequence of the complementary strand in 5′ → 3’ direction.
Answer:
In 3’→ 5′ direction, 3′ –
TACGTACGTACGTACGTACGTACGTACG-5′
In 5’→ 3′ 5′ direction, 5-
GCATGCATGCATGCATGCATGCATGCAT-3′.

Question 4.
If coding strand in a transcription unit is written as follows:
5′-ATGCATGCATGCATGCATGCATGCATGC – 3′ Write down the sequence of mRNA.
Answer:
UACGUACGUACGUACGUACGUACGUACG

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesize a semi-conservative model of DNA replication? Explain.
Answer:
The complementary base pairing property of DNA double helix led Watson and Crick to hypothesise a semi-conservative mode of DNA replication. Watson & Crick observed that the nitrogenous bases are in complementary pairing in two strands of the double helix of DNA molecule. Such an arrangement of DNA molecules led them to hypothesize the semi-conservative mode of replication of DNA.

Question 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:
The types of nucleic acid polymerases required for the synthesis of DNA and RNA are :

1. DNA polymerase I, II, and III – They help in the replication of DNA.
2. RNA dependent DNA polymerase – It helps in the synthesis of DNA from RNA (reverse transcription).
3. DNA dependent RNA polymerase – It helps in the synthesis of RNA from DNA (transcription).

In eukaryotes, there are at least three RNA polymerases in addition to those found in cell organelles.

• RNA polymerase I transcribes rRNA (28S, 18S, and 5.8 S).
• RNA polymerase II transcribes the precursor of mRNA called heterogeneous nuclear RNA (hnRNA).
• RNA polymerase III transcribes tRNA, 5SrRNA, and snRNAs.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
A. D. Hershey and Martha Chase performed an experiment to prove that DNA is the genetic material not the protein. They used T₂ bacteriophages which infect the Escherichia coil. To differentiate between DNA and protein during the experiment, they used radioactive isotopes of phosphorus (³²P) and sulphur (³⁵S) in the culture medium of bacterial hosts. They could not use radioactive isotnpes of carbon (¹⁴C) etc., because they are present in both molecules and would not distinguish the two. They grew two cultures of Eschcrichia cou.

One culture was supplied with radioactive sulphur, ³⁵S. The other culture was provided with radioactive phosphorus, ³²P. Radioactive sulphur gets incorporated into sulphur containing amino acids and therefore, becomes part of bacterial proteins. Radioactive phosphorus gets incorporated into nucleotides which form nucleic acids, mostly DNA. Therefore, bacteria of both cultures became labelled.

They then introduced bacteriophage T₂ in both bacterial cultures. The virus entered the bacteria where it multiplied. The viral progeny was tested in both cases. It was labelled, one type with radioactive protein and the other types with radioactive DNA. These labelled phages were introduced in new bacterial cells. It was found that phages with labelled protein did not make the bacterial host labelled, while those with labelled DNA made the host labelled. It indicated that viral DNA is the genetic material (not proteins) which is transferred to the infected host.

Question 8.
Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
Answer:

Repetitive DNA	Satellite DNA
(i) the sequence of N2 bases present in more than 1 copy in a genome.	(i) part of DNA  having repeated short sequences of N2 bases
(ii) Repeated DNA sequence may or may not be present in the text.	(ii) Repeated sequence occur in tandem
(iii) Variability may or may not be present	(ii) Variability occurs

(b) mRNA and tRNA
Answer:

mRNA	tRNA
(i) Large-sized RNA with cap and tail. (ii) Carries codon information	(i) Small-sized with 3-4 loops and a limb (ii) Carries infor­mation for the association of AA with anti-Condon for incor­poration

(c) Template strand and Coding strand
Answer:

Template strand	Coding strand
(i) The strand of DNA takes part in transcription.	(i) It does not take part in transcription.

Question 9.
List two essential roles of ribosomes during translation.
Answer:
Two essential roles of the ribosome during translation are as follows:

• They provide a surface for binding of mRNA in the groove of the smaller subunit of the ribosome.
• As a larger subunit of the ribosome has peptidyl transferase on its ‘P’ site, therefore it helps in joining amino acids by forming peptide bonds.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down sometime after the addition of lactose in the medium?
Answer:
Lac operon is switched on adding lactose in the medium, as lactose acts as inducer and make repressor inactive. Due to this switch on of lac operon system, (3-galactosidase is formed which converts lactose into glucose and galactose. As soon as lactose is consumed, the repressor again becomes active and causes a switch off (shut down) of the system.

Question 11.
Explain (in one or two lines) the function of the followings:

(a) Promoter
Answer:
It is a gene that lies near the operator which functions as binding site structural genes if the operator allows.

(b) tRNA
Answer:
Functions as adapter molecule that picks  up a particular amino – acid from the cellular pool and takes same over A site, m – RNA for incorporation into a polypeptide

(c) Exons
Answer:
Coding segments present in the primary transcript which on splicing by snRNP’s get joined to form functional m-RNA.

Question 12.
Why is the Human Genome project called a megaproject?
Answer:
HGP (Human Genome Project) is called a megaproject because:

• it involved many countries (USA, UK, Japan, France, Germany, China) for determining the nucleotide sequences of genes
• it involved sequencing 3 x 10⁹ base pairs costing 9 billion US dollars
• it required bioinformatics databasing and other high-speed computational devices for analysis, storage, and retrieval of information.

Question 13.
What is DNA fingerprinting? Mention its applications.
Answer:
DNA Fingerprinting: Every human individual is characterized by unique print at the fingertips. The study of fingers, palm, and sole print is called dermatologyphics’.

Like prints of the fingertips, each individual has a unique DNA fingerprint. Unlike the prints of a finger, the DNA fingerprints can not be altered by surgery. The latter is exactly similar in all the cells and tissues of an individual. It can not be changed by medical treatment. The distinction of individuals on the basis of DNA fingerprint is due to the sequence of nucleotides in whole genomic DNA.

The technique to identify a person on the basis of his/her DNA specificity is called DNA fingerprinting. This was invented by Sir Alec Jeffreys in 1984 at Leicester University U.K. In India, Dr. V. K. Kashyap and Dr. Lalji Singh started this technique at CCMB, Hyderabad.

Question 14.
Briefly describe the following:
(a) Transcription
Answer:
Transcription – Formation of-RNA over the template of DNA.

The snRNA formed has codon information similar to the sense or coding strand of DNA with just U replacing T.

• The DNA strand which functions as a template is a template or an anti-sense strand.
• Only one of the DNA strands is transcribed
• The main enzyme taking part in transcription is RNA polymerase.

(b) Polymorphism
Answer:
Polymorphism It is the occurrence of more than one form of genetic material
Types:

• Allelic polymorphism – multiple alleles in a gene. So it alters the structure and function of the protein formed.
• SNP or single nucleotide Polymorphism – Unique in every human being. Useful in locating specific alleles, disease-associated sequences.
• RFLP or Restriction Fragment Length polymorphism – Different sized fragments are formed by cleavage with same enzyme most RFPL have no effect on phenotypes.

(c) Translation
Answer:
Translation (Biosynthesis of proteins) Coded genetic message brought by m – RNA from DNA is charged into a polypeptide chain (proteins).

DNA transcription mRNA translation Proteins Materials required for translation are ribosomes, AA, t RNA’s, aninoacylt – RNA synthetase, m – RNA and same factors Step in Translation. Activation of Amino Acids → charging of t RNA→ Initiation → Elongation → Termination → Modification.

(d) Bioinformatics
Answer:
Science of handling, storing as databases, analysing, modeling and providing access to various aspects of biological information, especially molecules connected with genomies and proteomics
Applications

• Organisation of Biological Data
• Functional Genomics
• Proteomics, Pharmacogenomics
• Medical informatics, chemoinformatics
• Faster drey research.

2nd PUC Biology Molecular Basis of Inheritance Additional Questions and Answers

2nd PUC Biology Molecular Basis of Inheritance One Mark Questions

Question 1.
Structure formed by regulation + structural + operator+ promoter gene.
Answer:
Operon.

Question 2.
Capping and tailing are seen during the transcription of RNA.
a. How is this process done?
b. What is the use of this process?
Answer:
a. Capping is done by adding methylated guanosine at the 5′ end. Tailing is done by adding 200-300 adenylate residues at the 3′ end.
b. Capping and tailing are used to process the hnRNA. The fully processed hnRNA is called mRNA.

Question 3.
What are the group of cells or organisms which have the same hereditary characters?
Answer:
Clone.

Question 4.
What is a codon?
Answer:
It is the triplet nitrogenous base sequence which codes for one amino acid. It lies on the m- RNA.

Question 5.
What is an anticodon?
Answer:
It is the triplet nitrogenous bases in the t-RNA complementary to an mRNA codon. It identifies a particular codon on mRNA.

Question 6.
In the lac operon, there is no apo-repressor and co-repressor. But it is present in tryptophan operon.
a. Who proposed tryptophan operon?
b. What is the significance of the two types of repressors given above?
Answer:
a. Francois Jacob and Jacques Monod
b. Apo-repressor: This is a protein produced by the regulator gene which is unable to bind the operator gene.
Co-repressor: When tryptophan binds with the apo-repressor, it is known as co-repressor.

Question 7.
Name the enzyme which takes part in transcription.
Answer:
RNA Polymerase.

Question 8.
Name the enzyme that catalyzes
(a) Replication of DNA and
(b) Formation of RNA. (CBSE 1995)
Answer:
(a) Topoisomerase.
(b) RNA polymerase.

Question 9.
Which bond is made in DNA when joining the sugar and phosphoric acid?
Answer:
Phosphodiester bond.

Question 10.
Name the bond present between two adjacent nucleotides
Answer:
Phosphodiester bond.

Question 11.
Due to a mistake during transcription, ATG forms UAG in m-RNA. What change would occur in the polypeptide chain translated by this mRNA? (Cbse 1996)
Answer:
UAG is a termination codon and so at point protein synthesis will get stopped.

Question 12.
Name three different non – sense codons.
Answer:
UAA, UAG and UGA.

Question 13.
Write the full name of Sn RNP.
Answer:
Small nuclear Ribonucleo Proteins.

Question 14.
Name the scientist who proposed one gene-one enzyme hypothesis. (CBSE 1997)
Answer:
Beadle and Tatum.

Question 15.
Name the enzyme that joints the short pieces in the lagging strand during synthesis of DNA.
Answer:
DNA legase. (CBSE 1998)

Question 16.
In which direction 5′ – 3′ or 3′ -5′ are the new strands of DNA formed during replication ? (CBSE 1992, 2K)
Answer:
5′ – 3′ direction

Question 17.
Give the present-day representation of central dogma.
Answer:

Question 18.
State Chargaff s base complementary rule.
Answer:
The total molar amount of adenine in any specimen of DNA is always equal to that of thymine. In a given DNA A = T and G = C.

Question 19.
Define mutation
Answer:
It is an abrupt and distinct change in the structure of base pair. It is a discontinuous inheritable and sudden change in an organism.

Question 20.
What do you call the kind of mutation in which a single base is added to a base strand : (CBSE 2K)
Answer:
Frameshift mutation.

Question 21.
Sickle cell anaemia is caused due to abnormal haemoglobin. Which chain of haemoglobin is responsible for this disease?
Answer:
β – chain of haemoglobin

Question 22.
What do the triplets AUG and UGA respectively code for during proteins synthesis?
Answer:
AUG – Methionine UGA – Termination codon (Nonsense codon)

Question 23.
Name the technique used by Watson and Crick to propose the double-helical structure of DNA molecule?
Answer:

• X-ray crystallography
• X-ray diffraction method.

Question 24.
Who discovered nucleic acid DNA? What was it called them?
Answer:
Fredrich Meischer. It was called nuclein.

Question 25.
(a) What is the length of the pitch of helix?
(b) What is the distance between 2 base pairs is a stand of DNA?
Answer:
(a) 3.4 nm
(b) 34 nm.

Question 26.
Why is the distance between the 2 nucleotide chains in a DNA maintained almost constant?
Answer:
The complementary base pairing between the 2 strands i.e. adenine and thymine (double bond) and Guanine and cytosine (triple bond) is responsible for the uniform distance between the 2 strands.

Question 27.
Name the process which occurs in virus where the formation of DNA occurs from RNA.
Answer:
Reverse transcription.

Question 28.
Name the components ‘a’ and ‘b’ in the nucleotides with a parent given below. (CBSE, Delhi 2008)
Answer:

Question 29.
What are histones?
Answer:
Histones are positively charged proteins found in association with DNA in a eukaryotic cell.

Question 30.
Name 2 organisms where RNA is the genetic material.
Answer:
QB Bacteriophage, Tobacco mosaic virus.

Question 31.
Name the main enzyme involved in the replication of DNA.
Answer:
DNA dependent DNA polymerase enzyme.

Question 32.
Name the types of synthesis ‘a’ and ‘b’ occurring in the replication of DNA as shown below (CBSE 2008)
Answer:

• a – continuous synthesis
• b – discontinuous synthesis.

Question 33.
What is a replication fork in DNA?
Answer:
During DNA replication the unwinding of DNA leads to the formation of a ‘Y’ shaped structure to the 2 strands of DNA duplex. This is known as the replication fork.

Question 34.
Define a cistron
Answer:
A cistron is defined as the length of mRNA, that codes for a polypeptide.

Question 35.
What is meant by hnRNA?
Answer:
The hnRNA is the precursor of mRNA transcribed by RNA polymerase II in eukaryotic cells hn represents heteronuclear RNA.

Question 36.
When and at what end does the ‘tailing’ of hnRNA take place? (AI 2009)
Answer:
After splicing, tailing occurs at the 3′ end of hn RNA.

Question 37.
Why is hn RNA required to undergo splicing?
Answer:
Since hn RNA contains both the coding sequences (exon) and the non-coding sequences (introns), hn RNA has to undergo splicing for the removal of introns.

Question 38.
Who proposed the operon concept?
Answer:
Francois Jacob and Jacque Monod proposed the operon concept.

Question 39.
Name the induce of lac operon in E. Coli?
Answer:
Lactose.

Question 40.
Given below is a schematic representation of a lac operon in the absence of an inducer. Identify ‘a’ and ‘b’ in it
Answer:

a – Repressor
b – operator.

Question 41.
What term is given to a single base DNA difference?
Answer:
When the repressor binds to the operator, the operon is switched off and transcription is stopped.

Question 42.
Expand VNTR.
Answer:
Variable Number of Tandem Repeats.

Question 43.
Regulation of lac operon by a repressor is referred to as negative why is it so?
Answer:
When the repressor binds to the operator, the operon is switched off and transcription is stopped.

Question 44.
Name 2 plants whose genome has been sequenced.
Answer:
Rice and Arabidopsis.

Question 45.
Define DNA polymorphism
Answer:
Inheritable mutations at high frequency in a population. It refers to the variation at the genetic level.

Question 46.
Who discovered the techniques of DNA fingerprinting
Answer:
Alec Jeffreys.

Question 47.
What is a probe in DNA-finger printing?
Answer:
A probe is a short stretch of DNA, with the nucleotide sequence that is complementary to that of the VNTR sequence.

Question 48.
Name the branch of science that HGP is closely associated with.
Answer:
Bioinformatics.

Question 49.
Given below is the sequence of steps of transcription in eukaryotic cells.
Fill up the blank 1, 2, 3, 4 left in the sequence.
Answer:

Single nucleotide polymorphism (SNPs).

1. RNA polymerase
2. hn
3. processed RNA
4. tail.

Question 50.
Write any 3 unusual bases present in Yeast’s alanine tRNA with their sources.
(CBSE 2004)
Answer:
All tRNA have 2 unusual bases – dihydro uridine (derived from uracil) and pseudouridine (from uracil. The third common unusual base is hypoxanthine (from adenine).

2nd PUC Biology Molecular Basis of Inheritance Two Marks Questions

Question 1.
What is genetic code? What do you know about the discovery of genetic code?
Answer:
Genetic code is that sequence of three nitrogenous bases of mRNA in which genetic information for the synthesis of one amino acid is coded.

The triplet codons of the genetic codes are discovered for the first time by M.W. Nirenberg in 1950. He synthesized an RNA by the use of a repetitive sequence of Uracil which is called polyuracil (UUUUU …………). They added synthesized mRNA to a cell-free extract containing protein-synthesizing enzymes and ribosomes from E. coli together with a mixture of 20 amino acids. The only molecules synthesized in a polypeptide chain were phenylalanine and their number in the chain was one-third of the Uracil base on poly-U-m-RNA. This confirmed the triplet nature of the genetic code.

Question 2.
Label the diagram 1, 2, 3, 4, 5, 6. (CBSE 2004)
Answer:

• 5′ end
• Ribosome binding site
• Start
• Stop signal
• Open reading frames (ORFs)
• 3′ end.

Question 3.
Name the components (parts) A and B of the transcription unit ‘given below.
Answer:

A – Promoter
B – Coding strand.

Question 4.
(a) Who first proposed a semi-conservative mode of replication of DNA.
(b) Which organisms are used in this experiment?
(c) Name the techniques used
(d) What is the result of first, second, and 3rd generations?
Answer:
(a) Watson and Crick (1953)
Escherichia Coli

• Use heavy isotope ¹⁵N instead of normal ¹⁴
  
• Use of Cesium chloride-based density gradient configuration with ethidium bromide as a fluorochrome.
• First-generation DNA is hybrid as with intermediate heaviness due to the presence of both ¹⁴N and ¹⁵N strands. The parent generation is the heaviest.

Second generation 50% light (¹⁴N/¹⁴N) and 50% intermediate heavy (¹⁴N/¹⁵N). Third generation75% light (¹⁴N/¹⁴N) and 25% of intermediate heaviness (¹⁴N/¹⁵N). This is possible only if DNA is double-stranded with semi-conservative replication. (one parent strand and other new strands) UACGAG AGAUUUi

Question 5.

Study the messenger RNA segment given above which is complete to be translated into a polypeptide chain

• Write the codons and ‘a’ and ‘b’
• What do they code for?
• How is a peptide bond formed between 2 amino acids in the ribosome (CBSE 2008)

Answer:
(i) a – AUG
b – UAA | UAG | UGA

(ii) AUG codes for methionine.
UAA/ UAG/ UGA is stop / nonsense codon.

(iii) Peptide bond is formed between -COOH group of P- site amino acid and NH₂ – group of A – site amino acid with the help of ribozine peptidyl transferase provided by ribosome.

Question 6.
State any one reason to explain why RNA virus mutate and evolve faster than other viruses.
Answer:
RNA is an unstable highly reactive molecule due to its single-stranded structure and exposure of its nitrogen bases. But DNA is stable, the molecule, as its, nitrogen bases are not exposed, became its double-helical nature.

Repressor binds to the operator region
(o)  and prevent RNA polymerase from transcribing the given.
Look at the figure above depicting lac operon in E-Coii.
(a) What could be a series of events when an inducer is present in the medium in which E. Coli is growing.
(b) Name the inducer.
Answer:
(a) When the inducer is present in the medium it is absorbed at first slowly into the bacterium. The inducer binds with the repressor attached to the operator gene the repressor leaves the operator gene and allows the RNA polymerase to pass from the promotor to the structural genes for transcription or formation of a polycistronic mRNA.
(b) Lactose or galactoside.

Question 7.
Draw schematically a single polynucleotide strand (with at least three nucleotides)
Answer:

Question 8.
Differentiate between euchromatin and heterochromatin.
Answer:
Euchromatin

• These are the regions where chromatin is loosely packed.
• Euchromatin stains lighter
• This is transcriptionally more active.

Hetero chromatin

• These are the regions where chromatin is tightly packed
• Hetero chromatin stains darker
• This is transcriptionally less active or inert.

Question 9.
Write notes on the structural gene, regulator gene, and operator gene.
Answer:
Structural gene – It is a type of gene containing the code for the synthesis of enzymes necessary for lactose catabolism.
Regulator gene – The regulator gene is a type of control gene which is involved in lactose catabolism.
Operator gene – It is also a type of control gene involved in lactose metabolism.

Question 10.
Compare the roles of the enzymes DNA polymerase and DNA ligase in the replication fork of DNA.
Answer:
DNA polymerases the nucleotides in the 5’ → 3′ direction, as a continuous stretch on the template strand with 3′ → 5′ polarity and short stretches on the template strand with 5′ → 3′ polarity. → DNA ligase joins the short stretches of DNA formed on the template strand with 5’→ 3′ polarity.

Question 11.
Write the differences between mono-cistronic and polycistronic mRNAs.
Answer:

Monocistromic mRNA	Polycistromic mRNA
(1) It is the mRNA that can code for only one polypeptide i.e. it has one cistron. (2) it is normally found in eukaryotic cells.	(1) It is the mRNA that can code for more than one polypeptide i.e. it has more than one cistron. (2) It is found in prokaryotic cells.

Question 12.
Differentiate between Exons and Introns.
Answer:
Exons (HOTS):

• They are the coding sequence of DNA/RNA transcript, that form parts of mRNA and code for different regions of the polypeptide.
• They are joined together during splicing to make the information continuous.

Introns:

• Introns are non-coding sequences of DNA/ RNA transcript that do not become part of mRNA.
• They are removed during splicing.

Question 13.
Amino acids are the building blocks of protein. How is a protein synthesised from aminoacids?
Answer:
By linking the aminoacids with the help of peptide bonds.

Question 14.
Why is that transcription and translation can be coupled in the prokaryotic cell but not in eukaryotic cells?
Answer:
(a) In prokaryotes, mRNA does not require any processing to become active

(b) Transcription and translation occur in the same compartment cytosol, as there is no well-defined nuclear membrane. Therefore it can be coupled.

In eukaryotic mRNA has to be processed (splicing) before it becomes active. Since RNA is synthesized inside the nucleus and translation occurs in the cytoplasm, coupling of transcription and translation is not possible.

Question 13.
What is transcription? Name the enzyme catalyzing it.
Answer:
Transcription: The formation of mRNA from DNA in the presence of an enzyme is called transcription. It is the first stage of protein synthesis which is catalysed, by an RNA polymerase enzyme. The process of transcription involves the following steps:

1. Exposing of the bases of DNA: The two strands of DNA are separated due to the presence of an unwinding protein and thus, their bases are exposed. The exposed chain of DNA functions as a template for the synthesis of mRNA in the presence of RNA polymerase enzyme.

2. Base pairing: The ribonucleotides are jointed in a definite fashion on the exposed strand of DNA. G is bonded with ‘C’, ‘C’ bonded with ‘G’, ‘T’ bonded with ‘A’, and ‘A’ bonded with‘‘T’respectively.

3. Synthesis of RNA chain: The new ribonucleotide bonded on DNA template are jointed with the help of RNA polymerase and thus, forming a new chain of RNA. Then this mRNA is separated from DNA and reaches the cytoplasm. Where it combines with ribosomes and thus, initiating the synthesis of protein.

Question 16.
What is an operon? How does lactose act as an inducer in the lac operon? (Al 2008)
Answer:
All the genes controlling a metabolic pathway, collectively constitute an operon. Lactose binds to the repressor and inactivates it, and prevents it from binding to the operator. As a result, the RNA polymerase gets access to the promoter and transcription proceeds, ie., the operon is induced to function.

Question 17.
Explain VNTR as the basis of DNA fingerprinting.
Answer:

• Variable number of tandem repeats belong to the class of satellite DNA referred to as minisatellite.
• The number of repeats shows very high degree of polymorphism as a result the size of VNTR varies.
• After hybridization of DNA sample with VNTR probe, an autoradiogram developed which gives many bands give the characteristic pattern of an individual DNA.

Question 18.
Give the applications of DNA fingerprinting?
Answer:

• To identify criminals in the forensic labs.
• To determine the biological parent in case of dispute.
• To verify whether an immigrant is really a close relative of the mentioned resident.
• To identify racial groups to rewrite the biological evolution.

Question 19.
How is the nucleosome formed? Draw a diagram of the nucleosome.
Answer:

In eukaryotes, histones which are positively charged proteins, become organised as a unit of 8 molecules, called histone octamer. The negatively charged DNA is wrapped around the positively charged histone octamer, to form the structure, called a nucleosome.

Question 20.
What is meant by R – cells and S – a cell with which Frederick Griffith carried out his experiments on Diplococcus pneumonia? What did he prove from these experiments?
Answer:
R – cells are those bacterial cells that form rough colonies, without a capsule and are non-virulent. S – cells are those cells, that form smooth colonies, with a capsule and are virulent. He proved that virulence of S – cells had somehow been transferred into R – cells, which became transformed into S- cells, it is the genetic material that had affected transformation.

Question 21.
Draw the schematic representation to show the continuous or discontinuous synthesis of DNA (replication of DNA) and label it.
Answer:

Question 22.
Explain frames shift mutation.
Answer:

• It is the type of mutation where insertion or deletion of one or two bases changes the reacting frame from the point of insertion or deletion.
• When three or multiples of three bases are added there is the addition of one or more amino acids and the reacting of the frame remains unaltered after that. This provides genetic proof that codons are triplets.

Question 23.
A tRNA is charged with the amino acid phenylalanine.
(a) At what end of the tRNA is the amino acid attached?
(b) Give the mRNA codon that codes for phenylalanine.
(c) Which enzyme is responsible for this attachment?
Answer:
(a) Amino acid is attached to the 3′ end of tRNA.
(b) UUC or UUU are the codes for phenylalanine.
(c) Amino Acyl tRNA synthetase enzyme is responsible for this attachment.

Question 24.
(a) Draw the schematic diagram of tRNA showing the following.
(i) Methionine attached to the amino acid accept the site.
(ii) Correct base sequence at the anticodon loop.
(b) Write the role of “untranslated regions” on mRNA segment play in protein synthesis?
Answer:
(a)

(b) They are needed for efficient translation

Question 25.
Draw a labeled diagram depicting schematically the process of elongation in translation.
Answer:

Question 26.
Describe the goals of Human genoine project.
Answer:
The major goals of Human genome project are

• Determine the sequence of the 3 billion base pairs present in Human DNA.
• Identify the genes in the human DNA.
• Store the information in databases.
• Improve the tool for data analyses.
• Address ELSI (ethical, legal, social issues) that arise from the project.
• Transfer the technologies to other sectors.

2nd PUC Biology Molecular Basis of Inheritance Five Marks Questions

Question 1.
Describe the features of the double-helical model of DNA.
Answer:
The features of double-helical DNA are

• It is made up of 2 polynucleotides of sugar-phosphate and the nitrogen bases inside.
• The two chains have antiparallel polarity ie., one has 5′ → 3’ polarity and the other with 3′ → 5′ polarity.
• The bases of 2 strands are joined by a double hydrogen bond between adenine and thymine and a triple hydrogen bond between guanine-cytosine.
• The distance between 2 base pairs is 0.34nm and the distance between each turn is 3.4nm. Each turn consists of 10 base pairs.
• The plane of one base pair stacks over the other in double Helen this gives the stability of the double-helical structure.

Question 2.
(1) Represent diagrammatically the Watson Crick model for semi conservation replication of DNA.
(2) Differentiate between continuous and discontinuous synthesis of DNA.
Answer:

(2)

Continuous	Discontinuous
(a) One strand of DNA is synthesised as a continuous stretch in the 5′ → 3′ direction.	(a) Short stretches  are synthesised in the 5’→ 3′ direction from the replication fork
(b) The template strand of the DNA strand is with 3’→ 5′ polarity.	(b) The DNA strand with 5′ → 3′ polarity is the template strand for this.
(c) No need for enzyme ligase (for joining)	(c) DNA ligase enzyme is required for joining short stretches.
(d) There is no need for primers.	(d) There is a need for primers.

Question 3.
Write short notes on different types of RNAs.
Answer:
The RNAs are of 3 types

• Messenger RNA (m – RNA)
• Transfer RNA (t – RNA)
• Ribosomal RNA (r – RNA)

m – RNA It provides the template for polypeptide synthesis, ie., it decides the sequence of amino acids in the polypeptide through the sequence of bases on it. t – RNA It has the shape of a cloverleaf in a two-dimensional structure It transports the amino acids to the site of protein synthesis it recognizes the codon on m RNA. r – RNA It plays the structural and catalytic role during translation.

Question 4.
Define genetic code and write its salient features.
Answer:
Genetic code is the relationship between the sequence of nucleotides on mRNA and the sequence of amino acids in the polypeptide.
Its features are

• The genetic code is universal ie., the codons code for one amino acid is the same in all organisms.
• Codons are triplet codons and there are 64 codons. 61 codons code for twenty different amino acids while the other three (UAA, UAG, UGA) are termination codons that do not code for any amino acids.
• Each codon codes for only one particular amino acid. Therefore it is unambiguous.
• Some amino acids are coded by more than one codon there for it is said to be degenerate.
• The codons are read in a continuous manner, without any punctuation ie., codons are comma less.
• AUG has dual functions of coding for methionine as well as functioning as initiation codon.

Question 5.
(1) Represent schematically the process of transcription in eukaryotic cells.
(2) How does DNA polymerase function in the replication fork of DNA?
Answer:

(2) The DNA polymerase can catalase the polymerisation of nucleotides only in one direction is 5′ → 3′ direction.
On the template stand with 3′ → 5′ polarity the polymerisation occurs continuously and on the template strand with 5′ → 3′ polarity, polymerisation occurs in short stretches (discontinuous synthesis).

Question 6.
(a) Explain with the help of schematic representation, the lac operon in E-Coli.
(b) Mention the role of lactose in this operon.
Answer:
(a) Jacob and Monod explained that lactose inducer the expression of genes leading to its catabolism.

(b) Role of lactose

• Lactose is a substrate for the enzyme (3- galactosidase.
• Its functions as the inducer and regulates the switching on and off of the operon.
• When lactose is present, it combines with the repressor protein which otherwise has a high affinity for the operator.
• This inactivates the repressor from binding to the operator and hence transcription continuous ie., the operon is switched on.

You can Download Chapter 4 Reproductive Health Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 7 Evolution

2nd PUC Biology Evolution  NCERT Text Book Questions and Answers

Question 1.
Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory.
Answer:
When a bacterial population encounters a particular antibiotic, those sensitive to it, die. Sometimes a bacterial population happens to contain a few bacteria having mutations which make them resistant to the antibiotic. Such resistant bacteria survive and multiply quickly. Soon the resistance providing genes become widespread and entire bacterial population becomes resistant. This type of sorting out of the organisms with useful variations has been called as ‘natural selection’ by Darwin.

Question 2.
Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.
Answer:

• Fossil of small terrestrial dinosaur with feathers covering limbs and body. (Archaeopteryx lithographic)
• Mesohippus – intermediate horse size of goat with 3 toes on each foot and molar teeth had serration.

Question 3.
Attempt giving a clear definition of the term species.
Answer:
Species (used both as singular and plural) is a natural population of individuals or group of populations which resemble one another in all essential morphological and reproductive characters so that they are able to interbreed freely and produce fertile offspring.

Question 4.
Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)
Answer:

Question 5.
Find out through the internet and popular science articles whether animals other than man have self-consciousness.
Answer:
Yes, chimpanzees are most near to man than any other living animal and have self-consciousness.

Question 6.
List 10 modern-day animals and using the internet resources link it to a corresponding
ancient fossil. Name both.
Answer:
Please do survey in internet.

Question 7.
Practice drawing various animals and plants.
Answer:
Please practice drawing.

Question 8.
Describe one example of adaptive radiation.
Answer:
The process of evolution of different species in a given geographical area starting from a point and literally radiating to other areas of geography (habitats) is called adaptive radiation. Adaptive radiation gave rise to Australian marsupials. A number of marsupials, each different from the other evolved from an ancestral stock, but all within the Australian island continent.

Question 9.
Can we call human evolution adaptive radiation?
Answer:
No, we cannot call human evolution adaptive radiation

Question 10.
Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse.
Answer:
E.g.: Horse – See textbook diagram

2nd PUC Biology Evolution Additional Questions and Answers

2nd PUC Biology Evolution One Mark Questions 

Question 1.
Name the non-cellular organism.
Answer:
Virus.

Question 2.
It is said the earth has formed about 4.5 billion years back. How did the earth crust and atmosphere formed according to Big Bang theory?
Answer:
It is said there was no atmosphere on early earth and the earth was a hot ball of gases. With the passage of years, the gases condensed into a molten core and different elements got stratified according to their density. Heavy elements such as iron, nickel etc. sank deep into centre and formed the core. Lighter elements like silicon, aluminum etc. formed the middle layer, while the lighter elements like hydrogen, helium, nitrogen etc. formed the gaseous part.

Question 3.
Releasing of 02 by the evolution of photosynthesis an ancient time is called?
Answer:
Oxygen revolution.

Question 4.
Define analogous organs. (CBSE 93,94,2007)
Answer:
The organs which perform the same function but differ in their origin and structures are called analogous organs.

Question 5.
Where did life originate?
Answer:
In water.

Question 6.
What is paleontology?
Answer:
It is the branch of science that deals with fossils.

Question 7.
Name the method of the changing of the structure of a gene resulting in a variant form that may be transmitted to.
Answer:
Mutation.

Question 8.
Name any two vertebrate body parts that are homologous to human forelimbs.
(CBSE 2008)
Answer:
Wings of birds, flippers of whale forelimbs of cheetah, wings of bats.

Question 9.
Who wrote the origin of species?
Answer:
Charles Darwin.

Question 10.
Mention the type of evolution that has brought similarity as seen in potato tuber and sweet potato.
Answer:
Convergent evolution.

Question 11.
Who proposed the Recapitulation theory or Biogenetic law?
Answer:
Haeckel.

Question 12.
Thorns of Bougainvillea and tendrils of cucurbit are analogous or homologous.
Or
Wings of bird and forelimbs of horse are homologons or analogous
Or
Flippers of penguin and dolphin are analogous or Homologies.
What type of evolution has brought similarity in these cases? (CBSE 1992, Delhi 2009, Foreign 2009)
Answer:

• All these are homologous.
• Divergent type evolution has brought this similarity.

Question 13.
Name the theory by which earth is said to originate.
Answer:
The big bang theory.

Question 14.
What kind of evidence is afforded by Darwin’s finches in support of organic evolution? (CBSE 1991)
Answer:
Adaptive radiation i.e. All these finches evolved from a common ancestor but they diverge in various directions.

Question 15.
What is a mutation?
Answer:
New species originate due to changes of hereditary characters is called a mutation.

Question 16.
Define ontogenetic law.
Answer:
Ontogeny recapitulates phytogeny.

Question 17.
Which era is called the golden period of Dinosaurs?
Answer:
Mesozoic period is called the golden period of Dinosaurs.

Question 18.
As per Hugo deVries, what is the cause of speciation? (Delhi 2008, CBSE 1995)
Answer:
Mutation. (Single-step large mutation)

Question 19.
What is meant by genetic equilibrium?
Answer:
When allele frequencies in a population are stable, the allele frequency of a population remains constant. It is called as genetic equilibrium, i.e. the sum total of all the allelic frequency is one.

Question 20.
Define evolution as per Hardy Weinberg.
Answer:
As per Hardy Weinberg, change of frequency of alleles in a population would be considered as evolution i.e. disturbance in the genetic equilibrium.

Question 21.
Who is the early man of the modern human?
Answer:
Cro-Magnon peoples are early human of modern human.

Question 22.
What is meant by gene flow?
Answer:
Changes in the gene pool of population when there is continuous migration of organisms between them i.e. it refers to the addition or loss of genes.

Question 23.
Which human form first started to walk on two legs?
Answer:
Australopithecus form first started to walk on two legs.

Question 24.
Define natural selection?
Answer:
Natural selection is the process in which heritable variations that enable better survival, are enabled to produce and leave behind a greater number of progeny.

Question 25.
On the basis of evolution which human had a brain size of 1400cc?
Answer:
Neanderthal.

Question 26.
Define the term “reproductive isolation”.
Answer:
If the population of 2 different species whether they are isolated or not, cannot enter bread to produce offspring.

Question 27.
Differentiate between Dryopithecus and Ramapithecus.
Answer:
Dryopithecus was apelike but Ramapithecus was mostly human-like.

Question 28.
Name the group of animals that evolved into amphibians.
Answer:
Lobe-fins evolved into amphibians.

Question 29.
Mention the key concepts about the mechanism of biological evolution/ speciation according to
(a) Devries and
(b) Darwin (Delhi 2008)
Answer:
(a) De Vries – Mutation
(b) Darwin – Natural selection and branching descent.

2nd PUC Biology Evolution Two Marks Questions

Question 1.
What is a virus? Why is it treated as a link between living and non-living?
Answer:
Viruses are the simplest organisms of the earth, which consists of nucleic acid (DNA or RNA) surrounded by protein cover. It shows characteristics of living as well as non-living organisms.
(A) Living characters of virus:

• The virus shows structural differentiations.
• They contain hereditary material.
• They exhibit mutation.
• They spread plant and animal diseases.
• Growth and development present.
• They exhibit adaptation.
• They possess sensitivity.

(B) Non-living characters of virus:

• Lack protoplasm and cell organelles.
• Can be crystallized.
• No metabolic activities are seen.
• Cannot reproduce outside living cells.
• They lack enzymes.

Due to the above reason, viruses are considered as a link between the living and non-living organisms, thus, it is the first life that originated on the earth.

Question 2.
Life has originated in seawater. Justify the statement.
Answer:
According to Oparin and Haldane, the first cell protobionts arose in the broth (not dilute soup). So it is considered that life has originated in water.

Question 3.
Explain the origin of the earth.
Answer:
Origin of the earth:

• Earth was formed 4-5 billion years back.
• Initially, die surface was covered with water vapOur, methane, C02 and NH3.
• The UV rays of the sun broke water into hydrogen and oxygen.
• Hydrogen escaped and oxygen combined with NH3 and CH4 to form water, C02 and other gases, also forming die ozone layer.
• Cooling of water vapour led to rain which filled the depressions on earth’s surface, forming water bodies.

Question 4.
Ontogeny recapitulates phylogeny. Discuss.
Answer:
In the higher animals their development passes through stages which are similar to adult stages of lower animals which were their ancestors. For e.g. The tadpole larva of frog represents its fish like ancestors.

Question 5.
Given below are the names of 2 pairs of limbs. Categorize them into homologous and analogous organs, give reason.
(i) Human arm and fore leg of cow
(ii) Bat’s wing and Grass hopper’s wing. (CBSE 1999)
Answer:
(i) Human arm and foreleg of cow are homologous organs because they are built upon the same fundamental plan (pentadactyl pattern) but they perform different functions as grasping in man and locomotion in cow.

(ii) Bat’s wing and grass hopper’s wing are analogous organs because they perform the same function bat differ in their origin and structure. Wings of bats are modified forelimbs whereas grasshoppers wings are modified outgrowth of the body wall.

Question 6.
Give 2 examples each of analogy and homology in plants. (Hots)
Answer:
Analogy:

• Tubers of sweet potato and potato
• Tendrils of pea and cucurbits.

Homology:

• Tendrils of cucurbit and lemon thorn
• Tendrils of Pea and Spines of opuntia

Question 7.
What do you mean by analogous?
Answer:
Analogous organs: Organs which are different in origin and structure but per¬forming similar functions are known as analogous organs and the phenomenon is called an analogy. Analogous organs do not indicate phylogeny.
Examples: Wings of butterflies are made up of chitin, wings of birds made by production of feathers on forelimbs, and skin present between the fingers of bat are the examples of analogous organs.

Question 8.
Define adaptive radiation with 2 eggs. (Hots)
Answer:
Adaptive radiation is defined as the process of evolution of different species in a given geographical area starting from single species and radiated to other habitats.
Example:

• Australian marsupials, each different from the other, have evolved from ancestral stock.
• Darwin’s finches – from the original seed-eating stock insectivores and vegetarian birds have evolved.

Question 9.
What do you mean by vestigial organs?
Or
Write the two names of vestigial organs of man.
Or
What are vestigial organs? Explain. Write four vestigial organs of the human body.
Answer:
Vestigial organs: Organs that are reduced and have become functionless in an organism but were functional in their ancestors are called vestigial organs:
Examples:

• Vermiform appendix
• Coccygeal vertebrae
• The nictitating membrane in the eyes of human
• Muscles of external ear (Pinna).

2nd PUC Biology Evolution Three Marks Questions

Question 1.
Whose theory was put to test by Miller Urey and what was the theory? How did their experiment prove the abiotic origin of life on earth?
Answer:
Oparin and Haldane proposed that the first life form could have come from the „ nonliving organic molecules like RNA, protein etc.

• The orgaine molecules must have been produced by chemical evolution, i.e. formation of divers organic molecules from inorganic constituents.
• The condition, of the earth that favoured chemical origin were

(i) very high temperature
(ii) volcanic storms
(iii) Reducing atmosphere that contained methane, ammonia and water vapour.

• Energy must have been produced by U-V radiation and lightning.
• Analysis of the products of their experiment showed the presence of amino acids which help to form proteins.

Question 2.
Give a brief account as how evolution has taken pleace from the time the non-cellular aggregate of giant molecules turned into cells.
Answer:
The first formed cells were anaerobic heterotrophs. But slowly some of these cells developed coloured proteins, that could release oxygen, in a process that could have been similar to the light reactions of photosynthesis. As oxygen started coming into the atmospheres is as the atmosphere started becoming an oxidising one, new formes of life could not arise from nonliving organic molecules.

The organisms started becoming aerobic and autotrophic. The single celled organism slowly became multicellular form, where some became autotrophic while many remained heterotrophic. Plants like bryophytes were the first to invade land, followed by reptiles among animals.

Question 3.
Differentiate between natural selection and artificial selection.
Answer:

Natural selection	Artificial selection
(a) It is the process occurring in nature over a number of generations to increase the number of fit individuals in a population. (b) The characters/ adaptations are advantageous to the organism.	(a)  It is the process practised by man over a number of generations, to select organisms with better qualities. (b) The characters are advantageous human.

Question 4.
Fossils are the written documents of evolution. Comment on it.
Answer:
Palaeontological evidence:
The direct and concrete evidence of the process of evolution can be obtained from the study of fossils. The word fossil is derived from the Latin word fossilium meaning something dugout. The term fossil refers to the remnants of the previously existed animals and plants preserved in the earth’s crust. In other words, the fossil is the dead remains of the past. The remnants include bones, teeth, shells, and other hard parts and also the impressions or imprints left by some previous organisms.

The process of preservation of organisms or their parts in the form of fossils is known as fossilization. The fossils are regarded as the written documents of evolution. The study of fossils is called paleontology. It includes paleozoology (fossil animals) and paleobotany (fossil plants). Leonardo da Vinci is considered the Father of Palaeontology.

Question 5.
How is genetic drift differ from gene migration?
Answer:

Genetic drift	Gene migration
Random changes in the allele frequencies of a population occurring only by chance events constitute genetic drift.	It refers to the change in allele frequencies of a given population when individuals ‘ migrate into the population or leave the population.

Question 6
(a) Name the largest dinosaurs and mention any two characteristic features.
(b) How did Darwin explain the existence of different varieties of finches on the Galapagos Islands?
Answer:
(a) Tyrannosaurus rex was the largest dinosaur it was about 20 feet in height. It had huge fearsome dagger-like teeth

(b) Darwin explained that all the verities evolved on the island itself from the original seed-eating birds, many other forms with altered beaks arose some others became insectivorous while remained the vegetarian flinches. Such process of evolution of different species in a given geographical area, starting from a point and literally radiating to other habitats, is called adaptive radiation.

Question 7.
Explain Landmark’s theory of evolution with an example.
Answer:
According to Lamarck, the evolution of life forms had occurred, drives by the use and disease of organs. This theory is as known as the theory of inheritance of acquired characters. He gave the examples of giraffes, who in an attempt to forage leaves on tall trees had to stretch their neck. As they passed this acquired character to the next generations giraffe slowly over the years, came to acquire tons of necks.

Question 8.
Stanley Miller and Harold C Urey performed an experiment by recreating in the laboratory the probable condition of the atmosphere of the primitive earth.
i. What was the purpose of the experiment?
ii. In what forms was the energy supplied for the chemical reactions to occur?
Answer:
i. Stanley Miller gave an experiment based on the theory of the origin of life on earth.
ii. In primitive times at the time of formation of the earth, there was a non-oxygenated atmosphere of CH₄, NH₃, CO₂, CO, NO₂, H₂O (water vapours), etc. Due to cooling and compression caused by increased pressure, the chemicals reacted, compressed against each other, and cooled (liquefied) to form the first life on earth in water.

You can Download Chapter 5 Principles of Inheritance and Variation Questions and Answers, 2nd PUC Biology Question Bank with Answers, Karnataka State Board Solutions help you to revise complete Syllabus and score more marks in your examinations.

Karnataka 2nd PUC Biology Question Bank Chapter 5 Principles of Inheritance and Variation

2nd PUC Biology Principles of Inheritance and Variation NCERT Text Book Questions and Answers

Question 1.
Mention the advantages of selecting pea plant for the experiment by Mendel.
Answer:
Mendel selected garden pea for his experimental work because it had the following advantages:

• The pea plants showed a number of well-defined contrasting characters.
• It has perfect bisexual flowers containing both male and female parts. The flowers are predominantly self-pollinating.
• Because of self fertilisation, plants are homozygous. It is, therefore, easy to get pure lines for several generations.
• It is an annual plant. Its short life cycle made it possible to study several generations within a short period.
• It is easy to cultivate.
• It is easy to cross because pollen from one plant can be introduced to the stigma of another plant.

Question 2.
Differentiate between:-
(a) Dominance and Recessive.
Answer:

Dominance	Recessive
1. Able to express even in presence of contrasting alleles. 2. Does not require another similar allele to produce its phenotype. 3. Produces complete polypeptide, protein, or enzyme. 4.  It is usually wild type allele.	1. Cannot express in presence of contrasting alleles. 2. Can produce its phenotype only along with a similar allele. 3. Forms incomplete products. 4.  Usually a mutant allele.

(b) Homozygous and Heterozygous.
Answer:

Homozygous	Heterozygous
1. Possesses similar alleles. 2.  2 types – Homozygous dominant and recessive. 3. Individual is pure for the trait. 4. On self breeding, a similar types of offspring are formed. 5. Only one type of gamete is formed	1. Possesses different alleles. 2.  Is of one type 3. Individual is seldom pure for the trait. 4. On breeding, 3 types of offspring are formed. 5. 2 types of gametes produced.

(c) Monohybrid and Dihybrid
Answer:

Monohybrid	Dihybrid
1. Cross made between individuals having contrasting traits in order to study the inheritance of a pair of alleles. 2.  Phenotypic monohybrid ratio in F2 generation is 3:1. 3. Genotypic monohybrid ratio in F2 generation is 2:1.	1. Cross made between individuals having contrasting traits in order to study the inheritance of 2 pairs of alleles. 2. Phenotypic dihybrid ratio is 9:3:3:1 3. Genotypic dihybrid ratio is 1:2:1:2:4:2:1:2:1

Question 3.
A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?
Answer:
A diploid organism heterozygous for 4 loci will have the supported genetic constitution YyRr for two characters. The alleles Y-y and R-r will be present on different 4 loci. Each parent will produce four types of gametes – YR, Yr, yR, yr.

Question 4.
Explain the law of Dominance using a monohybrid cross.
Answer:
Law of Dominance:

• Characters are controlled by discrete units called factors.
• Factors occur in pairs.
• In a dissimilar pair of factors, one member of the pair dominates (dominant) the other (recessive) suppresses.

In a monohybrid cross:

Question 5.
Define and design a test cross.
Answer:
Test cross: An organism showing dominant phenotype (genotype is to be determined.) from F₂ is crossed with a recessive parent instead of self-crossing. Progenies of such a cross can be analysed to predict the genotype of the test organism. Eg: A tall and short plant taken into the experiment. From F₂ generation, TT or Tt could be tall  I plant. The recessive parent will be tt. So, if the test plant was TT, the resulting plant will only I tall. If the test plant was Tt, the resulting plant will be tall and short.

Question 6.
Using a Punnett square, workout distribution of phenotypic features in the F₁ generation after crossing between homozygous female and heterozygous male for a single locus.
Answer:

Question 7.
When the cross is made between a hybrid tall plant with yellow seeds (Tt Yy) and tall plant with green seeds (Tt yy), What proportion phenotype in offspring could be expected to be
(a) Tall and Green
(b) Dwarf and Green
Answer:

Question 8.
Two heterozygous plants are crossed. If 2 loci are linked what would the distribution of phenotypic features in F₁ generation in a dihybrid cross.
Answer:

Question 9.
Mention the contributions of TH Morgan in Genetics.
Answer:
Thomas Hunt Morgan (1866-1945) is called father of experimental genetics. He was an American scientists, famous for his experimental research with the fruit fly (Drosophila) by which he established the chromosome theory of heredity. He discovered presence of gene over chromosomes, chromosome theory of linkage, chromosome mapping, crossing over, criss-cross inheritance & mutability of genes. Morgan’s work played a key role in establishing the field of genetics. He received the nobel prize for physiology or Medicine in 1933.

Question 10.
What is pedigree analysis? Suggest how such analysis can be useful.
Answer:
Pedigree analysis: Study of transmission of particular traits graphically over the present and the last few generations for finding out the possibility of their occurrence in future generations. So, analysis of traits in several generations of a family is called Pedigree Analysis.
Importance:

• To know the possibility of a recessive allele which may create disorder.
• Can indicate the origin of a trait in the ancestors.
• Analysis is used for genetic counseling.
• Extensively used in medical research.

Question 11.
A child has blood group O. If the father has blood group A and mother B, work out genotypes of parent and the possible genotypes of other offsprings.
Answer:
Blood group O can appear with 1° 1° only (2 recessive alleles).

Question 12.
How is sex determined in human beings?
Answer:
Chromosomal determination of sex in human beings is of XX-XY type. Human beings have 22 pairs of autosomes and one pair of sex chromosomes. The female possess two homomorphic (= isomorphic) sex chromosomes, named XX. The males contain two heteromorphic sex chromosomes, i.e., XY. All the ova formed by female are similar in their chromosome type (22 + X). Therefore, females are homogametic. The male gametes or sperms produced by human males are of two types, gymnosperms (22 + X) and androsperms (22 + Y). Human males are, therefore, heterogametic.

Sex of the offspring is determined at the time of fertilisation. Fertilisation of the egg (22 + X) with a gynosperm (22 + X) will produce a female child (44 + XX) while fertilisation with an androsperm (22 + Y) gives rise to male child (44 + XY). As the two types of sperms are produced in equal proportions, there are equal chances of getting a male or female child in a particular mating. As Y-chromosomes determine the male sex of the individual, it is also called androsome.

Question 13.
Explain the following terms with an example
(a) Co-dominance
(b) Incomplete dominance
Answer:
a. Codominance is a condition in which the F₁ generation resembles both parents, (e.g. Blood groups).
b. The type of inheritance in which the F₁ does not show the dominant character but shows an intermediate character between the dominant and recessive is called incomplete dominance.

Question 14.
What is point mutation? Give one example.
Answer:
When heritable alterations occur in a very small segment of DNA molecule i.e., a single nucleotide or nucleotide pair, then these types of mutations are called point mutations (also called gene mutations). The point mutations may occur due to inversion, substitution (transition and transversion), and frameshift (insertion and deletion) type of nucleotide change in the DNA or RNA. Phenylketonuria (PKU; Foiling 1934) is an inborn, autosomal, recessive metabolic disorder in which the homozygous recessive individual lacks the enzyme phenylalanine hydroxylase needed to change phenylalanine (amino acid) to tyrosine (amino acid) in the liver. It results in hyperphenylalaninemia which is characterized by the accumulation and excretion of phenylalanine, phenyl pyruvic acid, and related compounds.

The lack of the enzyme is due to the abnormal autosomal recessive gene on chromosome 12. This defective gene is due to substitution. Affected babies are normal at birth but within a few weeks, there is a rise (30 – 50 times) in plasma phenylalanine level which impairs brain development. Other symptoms are mental retardation, decreased pigmentation of hair and skin, and eczema.

Question 15.
Who had proposed the chromosomal theory of inheritance?
Answer:
Sutton and Boveri proposed the chromosomal theory of inheritance. The theory believes that chromosomes are vehicles of hereditary information that possess mendelian factors or genes and it is the chromosomes which segregate and assort independently during transmission from one generation to the next.

Question 16.
Mention any two autosomal genetic disorders with their symptoms.
Answer:
Phenylketonuria: This inborn error of metabolism is also inherited as the autosomal recessive trait. The affected individual lacks an enzyme that converts the amino acid phenylalanine into tyrosine. As a result, this phenylalanine is accumulated and converted into phenyl pyruvic acid and other derivatives. Accumulation of these in the brain results in mental retardation.

Sickle cell anemia: This is an autosome liked recessive trait that can be transmitted from parents to the offspring when both the partners are carriers for the gene of heterozygous.

2nd PUC Biology Principles of Inheritance and Variation Additional Questions and Answers

2nd PUC Biology Principles of Inheritance and Variation One Mark Questions

Question 1.
Give the meaning of the term allele.
Answer:
It represents a pair of genes of 2 alter-natives of the same character and occupies the same position (locus) on the homologous chromosome. OR The various forms of genes are called alleles.

Question 2.
What is known as the alternative forms of a gene that can occupy the same locus on a particular chromosome and that controls the same character?
Answer:
Allelomorph.

Question 3.
Differentiate between mutants and mutons.
Answer:
Mutants: The organism showing mutation.
Mutons: The smallest segment of DNA which can undergo mutation.

Question 4.
What do you mean by heredity material which is found in the outer part of the chromosome?
Answer:
Plasmogene.

Question 5.
What term did Mendel use for what we now call the genes? [Hots]
Answer:
Factors or determination.

Question 6.
What do you say when a gene shows a dominant effect?
Answer:
Dominant gene.

Question 7.
Define Phenotype.
Answer:
The observable or external characteristics of an organism, constitute its phenotype.

Question 8.
What is meant by true breeding?
Answer:
True breeding means that the parents will also pass-down a specific phenotypic trait to their offspring.

Question 9.
Mendel studied seven traits in garden pea. Which one or more of the following were recessive?
Wrinkled seed, axial flower, yellow colour of pod, tall, purple flower.
Answer:
Wrinkled seed

Question 10.
What do you mean by Fj in mendels law?
Answer:
First fertile generation.

Question 11.
Name the plant in which Mendel performed his experiment.
Answer:
Pea plant – Pisum sativum.

Question 12.
Who gave the name ’X’ body? Which genes are select sex determination in human beings?
Answer:
Herman Henking suggested the name and occur.es the sex determination in humans by XX and XY chromosome.

Question 13.
Mendel observed 2 kinds of ratios, i.e., 3:1 and 1:2:1 in F₂ generation in his experiments on the garden pea. Name these two kinds of ratios respectively.
Answer:

• 3:1 – Phenotypic ratio
• 1:2:1 – Genotypic ratio.

Question 14.
Give one example of Co-dominancy.
Answer:
‘A’, ‘B’ and ‘O’ genes are co-dominant which found in blood group.

Question 15.
What is epistasis?
Answer:
It is the interaction between two different genes (non-allelic genes) where one gene masks the effect of another gene.

Question 16.
What do you mean by the diagrammatic representation of hereditary characters which shows specific characters from generation-to-generation?
Answer:
Pedigree analysis.

Question 17.
In man, four types of blood groups A, B, AB, and O are controlled by three alleles of a gene. Name the type of inheritance involved in the blood group.
Answer:
Multiple allelic inheritances.

Question 18.
Give the name of any allopolyploid species which is originated in a natural way.
Answer:
Wheat (Triticum astivum).

Question 19.
What is the phenotypic and genotypic ratio of incomplete dominance?
Answer:
The phenotypic and genotypic ratios are same i.e. 1AA : 2Aa : laa

Question 20.
When are individuals exhibiting morphological characteristics of both sexes in drosophila called this method?
Answer:
Gynandromorphy.

Question 21.
Name the pigment that gives colour to the skin of man.
Answer:
Melanin

Question 22.
Names a specific DNA segment which is functioned as a unit of heredity.
Answer:
Gene.

Question 23.
What are complementary genes?
Answer:
These are the two independent pairs of genes that interact to produce a trait together but each dominant gene alone does not show its effect.

Question 24.
What is the name of the arms of a chromosome?
Answer:
Chromatid.

Question 25.
Name the pigments that control skin colouration in man. [Hots]
Answer:
Melanin.

Question 26.
Who first observed the ‘X’ chromosome?
Answer:
Henking. [Hots]

Question 27.
Why ‘X’ chromosome is called a sex chromosome?
Answer:
It involves the sex determination of an individual.

Question 28.
Name the disease caused by inadequate or defective nutrition.
Answer:
Dystrophy.

Question 29.
Define heterogamety. Give an example.
Answer:
It is a phenomenon in which organisms produce 2 types of (more than one type) gametes.
Eg: Human male, male drosophila / female fowl.

Question 30.
What is the exception of Mendel’s Independent assortment theory?
Answer:
Linkage.

Question 31.
Give the term for the factors which cause mutation.
Answer:
Mutagens.

Question 32.
Mention 2 sex-linked Mendelian disorders.
Answer:
Haemophilia and colour blindness

Question 33.
Name some diseases which can be avoided in the progeny through pedigree analysis of parents.
Answer:
Colour blindness, Tuberculosis, Turner’s syndrome.

Question 34.
Give the reason for Down’s syndrome.
Answer:
Trisomy of 21st chromosome.

Question 35.
Define trisomic condition.
Answer:
When a particular chromosome is present in 3 copies in a diploid cell, the condition is called trisomic condition.

36.
Define monosomic condition.
Answer:
When a particular chromosome is present in a single copy in a diploid cell, the condition is called a monosomic condition.

2nd PUC Biology Principles of Inheritance and Variation Two Marks Questions

Question 1.
Define test cross. What is its significance?
Answer:
It is the cross between an individual with a dominant phenotype with an individual homozygous recessive for the trait. It is used to determine the genotype of an individual for any character trait.

Question 2.
What are multiple alleles? Give an example.
Answer:
When a gene exists in more than 2 allelic forms, the alleles are called multiple alleles.
Eg: The gene ‘I’ controls the human blood group. It exist in 3 different alleleic form i.e., I^A I^B and i.

Question 3.
Write T.H.Morgan’s contribution to genetics.
Answer:

• Morgan conducted experiments in Drosophila melanogaster and discovered sex linkage.
• He also found that linked genes may show the phenomenon called linkage where the recombinants in a test than 50%. cross progeny are less.

Question 4.
Differentiate between monohybrid and dihybrid.
Answer:

Monohybrid	Dihybrid
It is a cross, where 2 forms of the single trait are hybridised.	It is a cross where 2 forms of 2 different traits are hybridised.

Question 5.
Differentiate between genotypes and phenotype.
Answer:

Genotype	Phenotype
(a) It is the total genetic constitution of an individual.	(a) It is the external appearance of an individual.
(b) It is the expression of the genome or more specifically the alleles present at one locus.	(b) It is the expression of genotype produced under the influence of an environment.

Question 6.
Differentiate between test cross and reciprocal cross.
Answer:

Test cross	Reciprocal cross
It is a cross between, F1 hybrid and recessive parent. It confirms the purity of the F1 hybrid whether it is homozygous or heterozygous.	It is the second cross involving the same strains carried by sexes opposite to those in the first cross. It is able to distinguish between nuclear chromosomal and sex-linked inheritance.

Question 7.
Is not possible to study the inheritance of traits in humans in the same way as in peas? Give 2 main reasons for it and the alternative method used for such study.[Hots]
Answer:
Mendel’s laws are not applicable for human beings because:

• In human the generation time is too long and produces a small progeny. It creates difficulty in the statistical computation of any generation of individuals.
• Human cannot be crossed at will. Pedigree analysis is another method used to study the family instances and the transmission of particular trait generation after generation.

Question 8.
What is back cross?
Answer:
When an intercross done between 2 genetically different parents, a hybrid is produced which may be homozygous or heterozygous. To determine the purity of parents and to test genotypes of F₁ hybrid, a cross is made between F₁, hybrid and of the parent. Such cross is known as backcross.

Question 9.
How would you find the genotype of an organism exhibiting a dominant phenotypic trait?[Delhi 2008]
Answer:
First a test cross will be done between the dominant phenotypic individual (F₁ hybrid) with the recessive phenotypic individual (parent). If the individuals are homozygous dominant, all the individuals in the progeny

If the individuals are heterozygous, the progeny will show dominant phenotype and recessive phenotype in the ratio 1:1.

Question 10.
Give the structure of E. coli chromosome.
Answer:
Isolated E. coli chromosomes display many individually supercoiled loops emanating from a central region. These supercoiled loops were hypothesized to be topological domains. These domains are sufficient to generate the observed precision of E. coli chromosome structure. Its chromosomal DNA has been completely sequenced by lab researchers. E. coli has a single chromosome with about 4,600 kb, about 4,300 potential coding sequences, and only about 1,800 known E. coli proteins.

Question 11.
What is meant by chromosomal abberation? In which type of cells it commonly occurs?
Answer:
Alternation in chromosomes is due to the deletion/duplication/addition of a segment of DNA is called chromosomal abberation. Commonly occurs in cancerous cells.

Question 12.
What is a modifier gene?
Answer:
Modifier genes, instead of making the effects of another gene. A gene can modify the expression of a second gene. In mice, coat colour is controlled by the B gene. THeB allele conditions black coat colour and is dominant to the b allele that produces a brown coat.

Question 13.
Classify the following into chromosomal and Mendelian disorders.
(a) Cystic fibrosis
(b) Turner’s syndrome
(c) Klinefelter’s syndrome
(d) Hemophilia
Answer:
(a) Cystic fibrosis – Mendelian disorder
(b) Turner’s syndrome – Chromosomal disorder
(c) Klinefelter’s syndrome – Chromosomal disorder
(d) Haemophilia – Mendelian disorder

Question 14.
Describe the causes of hereditary variation.
Or
Why do hereditary variations originate?
Answer:
Any change in the structure of the gene of an organism will produce heritable variations. The chief causes of these variations are as follows:

(i) Genetic recombination: The exchange of chromosomal segments of genes takes place during reduction division which causes recombination of genes. These recombinant organisms fuse to form a zygote. The genetic structure of these zygotes is different from their parents. Adults formed from this zygote will show variations.

(ii) Changes in the number of chromosomes: Changes in the number of chromosomes will also cause genetic variations, e.g., modern varieties of wheat contain 16,21 and 42 chromosomes. These varieties are produced from their parents having only 7 chromosomes.

(iii) Changes in the structure of genes: Changes in the structure of genes will also cause genetic variations, e.g., 30 varieties of wheat is the best example of genetic variations. Like this, if any changes in the genes of human beings which are related to pigment production, will inhibit the production of these pigments and thus man become albino.

Question 15.
Explain how an XXY individual can arise in humans.
Answer:
An XXY individual can arise if an abnormal egg with XX chromosomes fertilizes with a normal sperm carrying Y’ chromosome.

Question 16.
Why are women normally carriers of sex-linked diseases? Write with an example.
Or
Men are generally suffering from color-blindness but women are only carriers of this disease. Explain the reason.
Answer:
The gene for color-blindness is recessive and carried by X-chromosomes. A color-blind man has a single recessive gene (X^CY). The gene for normal vision is dominant. When sex chromosomes (X) of a man contain genes for color-blindness (X^C), they express themselves and produce color-blindness in them. A carrier woman contains one recessive gene which remains suppressed due to the presence of the dominant gene of normal vision on the other sex chromosomes (X^CX). These women play important role in the conduction of genes of color-blindness. Hence, they are carrier (X^CX). Women become color-blind only when both chromosomes contain the genes of color-blindness (X^CX^C).

Question 17.
Differentiate between haemophilia and sickle cell anemia.
Answer:

Haemophilia	Sickle cell anaemia
1. It is due to recessive defective allele present on X – chromosome. 2.  It is a sex-linked ‘disorder. 3.  A protein necessary for clotting of blood is deficient.	1. It is due to point mutation i.e., a single base pair change leading to a change in amino acid. 2. It is an autosomal disorder. 3. The defective haemoglobin leads to a change in the shape of RBCs, which become a sickle cell.

Question 18.
Differentiate between Turners and Klinefelter’s syndrome.
Answer:

Turner’s Syndrome	Klinefelter’s Syndrome
1. The individual is female.	1. The individual is male.
2. The individual has one X chromosome less i.e., she has 45 chromosomes.	2. The individual has an extra X chromosome i.e., 47 chromosomes.
3.The individual has a short stature with an underdeveloped feminine character.	3. The individual has a tall stature with a feminised character.

Question 19.
Describe Mendel’s observation on the hybridization experiments on the garden pea.
Answer:

• The F hybrids always showed one of the parental forms of the trait and there was no blending of traits.
• Both the parental form of traits appeared without any change / blending in the F₂ generation.
• The form of the trait that appeared in the F₁ generation is called the dominant character and it appeared in the F₂ generation about 3 times in frequency as that of its alternate form.

Question 20.
Why Mendel selected pea plants for his experiments?
Answer:
Mendel selected pea plants on the basis of the following characters:

• The Pea plant exhibited a number of contrasting characters.
• It normally undergoes self-pollination but can be cross-pollinated manually.
• It is an annual plant and yield’s results in a year’s time, so it can be observed for many generations.
• Many varieties were available with observable alternative forms for a trait.
• Pure varieties of pea were available which always bred true.
• A large number of seeds are produced per plant which can be easily handled and cultivated.

Question 21.
List any 7 traits in garden pea which Mendel studied in his breeding
Answer:

Question 22.
What is Klinefelter’s syndrome? Also, describe their symptoms.
Answer:
Klinefelter’s syndrome: It is a sex chromosomal syndrome. It is found only in men. They possess 47 chromosomes in their cells (22 pairs autosomes + XXY sex chromosomes). One extra X chromosome is found in them, thus, there is Trisomy in the sex-chromosome.

Question 23.
A pea plant with Purple flowers was crossed with a plant with white flowers producing 40 plants with only purple flowers. On selfing, these plants produced 470 plants with purple flowers 162 with white flowers. What genetic mechanism accounts for these results?
Answer:

F₂ generation 470 purple: 162 white. In the F₁ generation only purple flower-producing plants appeared. This means the purple colour is dominant. Which doesn’t allow the white colour to express itself.

In F₂ generation, purple and white coloured flowers were produced in the ratio 3:1. Here the parental character of white again reappeared in about one-fourth of the progeny. This occurs due to the segregation of genes in the gamete formation. This represents the law of segregation and the monohybrid ratio.

Question 24.
In human beings, blue eye colour is recessive to brown eye colour. A brown-eyed man has a blue-eyed mother
(a) What is the genotype of the man and his mother?
(b) What are the possible genotype of his father?
(c) If a man marries a blue-eyed woman, what are the possible genotypes of their offsprings?
Answer:
As per the given condition, the brown eye colour is dominant over the blue eye colour.

(a) The mother’s genotype must be ‘bb’ as she is recessive for blue coloured eye. The man is brown-eyed (dominant). Its possible genotype must be ‘Bb’ as he is procuring one of the recessive gene from his mother.

(b) As the genotype of the man is ‘Bb’ so the possible genotypes of his father may be BB or Bb

Question 25.
How do you relate dominance, codominance, and incomplete dominance in the inheritance of character?
Answer:

• Dominance: It is the phenomenon in which one of the alleles of a gene expresses itself in the hybrid / heterozygous condition. While the other is suppressed (recessive) in the presence of the other.
• Codominance: It is the phenomenon in which 2 alleles of a gene are equally dominant and express themselves in the presence of the other
• Incomplete dominance: It is the phenomenon in which neither of two alleles of a gene is completely dominant over the other and the hybrid is intermediate between the two parents.

Question 26.
Describe the XO- type of sex determination. [HOTS]
Answer:
XO – type of sex determination occurs in certain insects like grasshoppers. The males have only one X – chromosome and hence they have one chromosome less than females. All the ova contains autosomes and one X chromosome. 50% of the sperm contains one X chromosome besides the autosomes, while 50% of sperm don’t have X – chromosomes. Sex of the individual is determined by the type of sperm fertilizing ovum. Egg fertilized by sperm having an X- chromosome developed into female. Egg fertilized by sperm having no chromosome develop into male.

Question 27.
Describe the different types of mutation.
Answer:

• A mutation is a phenomenon arising from the alteration of DNA sequences or structure or number of chromosomes.
• Loss (deletion) or gain (insertion/duplication) of a segment of DNA results in the alteration in chromosome structure, which is called a chromosomal aberration.
• When a mutation arises due to a change in single base pair of DNA, it is known as a point mutation. Eg: Sickle cell anaemia. Deletion or addition of base pairs of DNA causes frameshift mutation.

2nd PUC Biology Principles of Inheritance and Variation Five Marks Questions

Question 1.
What is incomplete dominance? Describe with one example.
Answer:
When 2 parents are intercrossed with each other, the hybrid that produced doesn’t resemble either of the parents, but mid-way between 2 parents. The phenomenon of incomplete dominance occurs in the Four O’clock plant (Mirabilis Jalopa) and Snapdragon (Antirrhinum Majus). A cross between red-flowered (RR) and a white-flowered (rr) plant yields the hybrid flowered (Rr) one which is of pink colour in F, generation.

The pink hybrids on crossing with each other give the usual Mendelian ratio 1 : 2 : 1 (one red : 2 pink : 1 white). In this, the gene “R is not completely dominant over the allele ‘r’. The heterozygous Rr synthesizes only half pigment, so they are pink in colour.

Question 2.
In Snapdragons, tall (DD) is dominant over dwarf (dd) and Red (RR) is incompletely dominant over white (rr), the hybrid being pink. A pure tall white is crossed to a pure dwarf red and F₂ is self-fertilized. Give the expected genotype and phenotype in F₁ and F₂ generations.
Answer:

Question 3.
Sex determination is based on particular chromosomes in both birds and humans. State two points of difference between their mechanisms of sex determination.
Answer:
i. In birds female has dissimilar chromosomes (ZW) and male has two similar ZZ chromosomes.
But in humans female has XX (homogametic) and male has XY (heterogametic)
ii. In humans the sperm is responsible for the sex of child but in birds egg is responsible for the sex of the chicks.

Question 4.
Study the Pedigree analysis chart and answer the question given below: [CBSE 2008]
Answer:

(a) Is the trait recessive or dominant?
(b) Is the trait sex-linked or autosomal?
(c) Give the genotypes of the parents in Generation I and of their 3rd and 4th child in Generation II.
Answer:
(a) The trait is recessive
(b) The trait is autosomal
(c) Parent Aa and Aa
3rd child is II generation – aa 4th child is II generation – Aa

Question 5.
Study the given pedigree chart to show the inheritance pattern of a human trait and answer questions given below.
(a) Give the genotype of a parent in 1st generation and of son and daughter were shown in 2nd generation.
(b) give the genotype of daughters shown in 3rd generation.
(c) Is the trait sex-linked or autosomal. Justify your answer.
Answer:
(a) Genotypes of parents in Generation 1. Male – Aa Female – Aa Son (Generation II) – Aa Daughter (Generation II) – aa.
(b) Genotype of the daughter in Generation III – Aa
(c) It is an autosomal trait and not sex-linked because if it is sex-linked, the daughter in generation II cannot have it.

Question 6.
A girl baby has been reported to suffer from haemophilia. How is it possible? Explain with the help of a cross.
Answer:
(a) Haemophilia is due to the presence of a recessive defective allele on the X – chromosome.
(b) A female with XX – chromosome must be homozygous for the disease to appear.
(c) She must receive one of the alleles from her haemophilie father (X^hY) and the other from her mother who is also an haemophilie or at least a carrier i.e. the heterozygous for the disease XX^h.

Question 7.
How are Pedigree charts prepared?
Answer:

• Squares denote males.
• Circles denote females.
• Mating is shown by a horizontal line connecting a male symbol with a female symbol.
• Offsprings symbols are rearranged from left to right in the order of their birth and connected by a horizontal line below the parents and this line is connected to the parent’s marriage line by a vertical line.
• A solid or blackened symbol represents the individual with the trait under study.
• An open/clear symbol represents the absence of a trait under study.